In this study, DNA was extracted from the Giemsa-stained bone marrow aspirate smear of each patient using the protocol modified from Court et al.19 Bone marrow material was scraped from the slide, using a sterile scalpel blade, directly to an Eppendorf centrifuge tube containing the digestion buffer, as described,19 and was incubated at 55°C overnight. After overnight digestion, DNA extraction was performed using the Puregene DNA Isolation Kit (Gentra Systems, Minneapolis, MN) following the manufacturer's protocol. The amount of DNA was quantified spectrometrically (Lambda 3A; Perkin-Elmer, Norwalk, CT). As a positive control for the quality of the extracted DNA, all DNA samples were tested by an in-house real-time quantitative polymerase chain reaction (PCR) assay targeting on β-globin. This ensured that the extracted DNA was suitable for further PCR analysis of IgH mutation status. PCR amplification of V_H genes included preamplification and amplification steps. For preamplification, approximately 25 to 250 ng DNA, 2 pmol each V_H leader primer, and the J_H primer were used. The reaction was carried out in a 25-μL volume with Advantage 2 PCR enzyme system (Clontech, Palo Alto, CA). The amplification program consisted of 30 cycles of 45 seconds at 94°C, 45 seconds at 55°C, and 60 seconds at 72°C, followed by a final incubation step at 72°C for 5 minutes. For the second amplification, the 25-μL reaction was carried out, using 2 μL first-round reaction mixture, 2 pmol each V_H family-specific forward primers, and the J_H

primer. The amplification program consisted of 25 cycles of 45 seconds at 94°C, 45 seconds at 60°C, and 60 seconds at 72°C, followed by a final incubation step at 72°C for 5 minutes. Then 4 μL PCR product was analyzed by electrophoresis in 2% agarose gel and ethidium bromide staining. The PCR products were directly sequenced after purification with MultiScreen Filtration System (catalog no. MAFBN0B10; Millipore, Danvers, MA) using an automated ABI PRISM 310 Genetic Analyzer. Nucleotide sequences were aligned to EMBL/GenBank and V-BASE sequence directory. A V_H gene with somatic mutations was defined as previously reported.20 V_H leader primers: V_H1 and V_H7, CACCATGG ACTG(G/C)ACCTGGA; V_H2, CAC(A/G)CTC CTGCTGCTGACCA; V_H3, CACCATGGAGTTTGGGCTGA; V_H3*, GGCTGAGCTGG(C/G)T TTT(C/T)CT(C/T)GT; V_H4, T(C/G)CTGGTGGC(A/G)GCTCCCAGA; V_H5, TCCTCCTGGCT GTTCTCCAA; V_H6, ACAATGTCTGTCTCCTTCCTCAT. V_Hfamily-specific forward primers: V_HF1/VHF7, CAGGT(C/G)CAGCTGGT(A/G)CAGTCTGG; V_HF2, CAG(A/G)TCACCTTGA AGGAGTCTGG; V_HF3, AGGTGCAGCTGGTGGAGTCTGG; V_HF4, CAGGTGCAGCTGCA GGAGTCG; V_HF5, GA(A/G)GTGCAGCTGGTGCAGTCTG; V_HF6, CAGGTACAGCTGCA GCAGTCAGG. J-chain primers: J_H primer, ACCTGAGGAGACGGTGACC; JH* primer, TGAGGAGACGGTGACC(A/G)(T/G)(T/G)GT.

NA indicates not applicable; CDR, complementarity-determining regions; FR, framework region; S Mut, silence mutation; and R mut, replacement mutation.