Comparison of top genes differentially expressed between intermediate CD14++CD16+ and nonclassical CD14+CD16++ monocytes
| Gene symbol . | Gene title . | Tag sequence . | CD14++CD16+ TPM . | CD14+CD16++ TPM . | P . | Fold change . | Protein function . |
|---|---|---|---|---|---|---|---|
| Top genes up-regulated in intermediate CD14++CD16+ monocytes compared to nonclassical CD14+CD16++ monocytes | |||||||
| HLA-DRA | MHC complex, class II, DR alpha | CATGGGGCATCTCTTGTGTACTTATT | 7564.9 | 2615.9 | 0 | 1.5 | MHC II Ag presentation |
| LYZ | Lysozyme | CATGATGTAAAAAATACAAACATTCT | 6770.6 | 1063.6 | 0 | 2.7 | Antimicrobial agent |
| CD74 | CD74 molecule, MHC class II invariant chain | CATGGTTCACATTAGAATAAAAGGTA | 30 285.4 | 13 911.5 | 0 | 1.1 | MHC II Ag processing; cell-surface receptor for MIF |
| IFI30 | IFN γ-inducible protein 30 | CATGATCAAGAATCCTGCTCCACTAA | 5312.1 | 2128.7 | 2.1 ×10−253 | 1.3 | MHC II Ag processing |
| S100A8 | S100 calcium-binding protein A8 | CATGTACCTGCAGAATAATAAAGTCA | 1557.0 | 283.7 | 8.6 ×10−171 | 2.5 | Calcium-binding protein with antimicrobial activity |
| HLA-DPB1 | MHC complex, class II, DP beta 1 | CATGTTCCCTTCTTCTTAGCACCACA | 1497.9 | 340.2 | 6.3 × 10−140 | 2.1 | MHC II Ag presentation |
| TMSB10 | Thymosin beta 10 | CATGGGGGAAATCGCCAGCTTCGATA | 3314.6 | 1650.4 | 1.8 × 10−104 | 1.0 | Organization of the cytoskeleton; cell motility, differentiation |
| SECTM1 | Secreted and transmembrane 1 | CATGACTCGAATATCTGAAATGAAGA | 1756.7 | 803.6 | 3.5 × 10−67 | 1.1 | Hematopoietic and/or immune system processes |
| FAU | Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed | CATGGTTCCCTGGCCCGTGCTGGAAA | 1384.8 | 566.0 | 2.7 ×10−65 | 1.3 | Fusion protein (ubiquitin-like protein fubi and ribosomal protein S30) |
| CPVL | Carboxypeptidase, vitellogenic-like | CATGATTAATCGATTCATTTATGGAA | 470.5 | 57.9 | 5.1 × 10−65 | 3.0 | Processing of phagocytosed particles, inflammatory protease cascade |
| PPIA | Peptidylprolyl isomerase A (cyclophilin A) | CATGCCTAGCTGGATTGCAGAGTTAA | 1817.5 | 900.2 | 8.7 × 10−59 | 1.0 | Accelerate the folding of proteins; formation of infectious HIV virions |
| CD14 | CD14 molecule | CATGTGGTCCAGCGCCCTGAACTCCC | 406.2 | 56.4 | 3.0 × 10−53 | 2.8 | Mediate the innate immune response to bacterial lipopolysaccharide |
| S100A10 | S100 calcium-binding protein A10 | CATGAGCAGATCAGGACACTTAGCAA | 813.2 | 277.8 | 1.4 × 10−50 | 1.5 | Cell-cycle progression and differentiation; exo- and endocytosis |
| FOS | FBJ murine osteosarcoma viral oncogene homolog | CATGTGGAAAGTGAATTTGAATGAAA | 287.1 | 17.8 | 2.3 × 10−50 | 4.0 | Forming the TF complex AP-1; proliferation, differentiation |
| TNFAIP2 | TNF α-induced protein 2 | CATGACTCAGCCCGGCTGATGCCTCT | 757.5 | 268.9 | 6.5 × 10−45 | 1.5 | Mediator of inflammation and angiogenesis |
| Top genes up-regulated in nonclassical CD14+CD16++ monocytes compared to intermediate CD14++CD16+ monocytes | |||||||
| CFL1 | Cofilin 1 | CATGGAAGCAGGACCAGTAAGGGACC | 2871.6 | 6395.0 | 1.8 × 10−266 | −1.2 | Actin dynamics; cell motility |
| IFITM2 | IFN-induced transmembrane protein 2 (1-8D) | CATGACCATTCTGCTCATCATCATCC | 1727.6 | 4362.8 | 3.7 × 10−230 | −1.3 | Immune response |
| GNAI2 | Guanine nucleotide-binding protein (G protein), α inhibiting activity polypeptide 2 | CATGTTTTATGGAATTGTTCACCTGG | 1270.8 | 3523.6 | 5.1 × 10−216 | −1.5 | Regulation of adenylate cyclase |
| NPC2 | Niemann-Pick disease, type C2 | CATGTCTCTTTTTCTGTCTTAGGTGG | 1286.2 | 3394.3 | 6.4 × 10−193 | −1.4 | Transport regulation of cholesterol through endosomal/lysosomal system |
| MYL6 | Myosin, light chain 6, alkali, smooth muscle and non-muscle | CATGGTGCTGAATGGCTGAGGACCTT | 2431.1 | 4885.7 | 6.2 × 10−163 | −1.0 | Regulatory light chain of myosin |
| CDKN1C | Cyclin-dependent kinase inhibitor 1C (p57, Kip2) | CATGCCCATCTAGCTTGCAGTCTCTT | 948.6 | 2611.5 | 6.2 × 10−159 | −1.5 | Negative regulator of cell proliferation |
| LYN | v-yes-1 Yamaguchi sarcoma viral-related oncogene homolog | CATGATGTGTTTCACTTATGCTGTTG | 1000.9 | 2602.6 | 6.2 × 10−145 | −1.4 | Cell proliferation, migration |
| LAPTM5 | Lysosomal protein transmembrane 5 | CATGGCGGTTGTGGCAGCTGGGGAGG | 1866.4 | 3905.3 | 2.4 × 10−143 | −1.1 | Transmembrane receptor associated with lysosomes |
| OAZ1 | Ornithine decarboxylase antizyme 1 | CATGTTGTAATCGTGCAAATAAACGC | 2649.6 | 4934.8 | 1.4 × 10−135 | −0.9 | Regulation of polyamine biosynthesis |
| HLA-B | MHC, class I, B | CATGCTGACCTGTGTTTCCTCCCCAG | 4623.1 | 7133.3 | 2.6 × 10−104 | −0.6 | HLA class I heavy chain paralogue; Ag presentation |
| B2M | β2-microglobulin | CATGGTTGTGGTTAATCTGGTTTATT | 6510.0 | 9267.9 | 2.0 × 10−93 | −0.5 | Association with the MHC I heavy chain |
| STK10 | Serine/threonine kinase 10 | CATGGCAGAAGCACAGGTTCTGTACC | 359.1 | 1137.9 | 3.4 × 10−85 | −1.7 | Cell-cycle progression; involved in MAPKK1 pathway |
| PSAP | Prosaposin | CATGAAGTTGCTATTAAATGGACTTC | 6670.3 | 9190.7 | 9.0 × 10−78 | −0.5 | Catabolism of glycosphingolipids |
| CSTB | Cystatin B (stefin B) | CATGATGAGCTGACCTATTTCTGATC | 424.2 | 1186.9 | 4.5 × 10−75 | −1.5 | Thiol protease; intracellular degradation and turnover of proteins |
| LSP1 | Lymphocyte-specific protein 1 | CATGCAGGATGCTTGATGCTGCGTCC | 1138.0 | 2237.1 | 8.7 × 10−72 | −1.0 | Regulation of motility, adhesion, and transendothelial migration |
| Gene symbol . | Gene title . | Tag sequence . | CD14++CD16+ TPM . | CD14+CD16++ TPM . | P . | Fold change . | Protein function . |
|---|---|---|---|---|---|---|---|
| Top genes up-regulated in intermediate CD14++CD16+ monocytes compared to nonclassical CD14+CD16++ monocytes | |||||||
| HLA-DRA | MHC complex, class II, DR alpha | CATGGGGCATCTCTTGTGTACTTATT | 7564.9 | 2615.9 | 0 | 1.5 | MHC II Ag presentation |
| LYZ | Lysozyme | CATGATGTAAAAAATACAAACATTCT | 6770.6 | 1063.6 | 0 | 2.7 | Antimicrobial agent |
| CD74 | CD74 molecule, MHC class II invariant chain | CATGGTTCACATTAGAATAAAAGGTA | 30 285.4 | 13 911.5 | 0 | 1.1 | MHC II Ag processing; cell-surface receptor for MIF |
| IFI30 | IFN γ-inducible protein 30 | CATGATCAAGAATCCTGCTCCACTAA | 5312.1 | 2128.7 | 2.1 ×10−253 | 1.3 | MHC II Ag processing |
| S100A8 | S100 calcium-binding protein A8 | CATGTACCTGCAGAATAATAAAGTCA | 1557.0 | 283.7 | 8.6 ×10−171 | 2.5 | Calcium-binding protein with antimicrobial activity |
| HLA-DPB1 | MHC complex, class II, DP beta 1 | CATGTTCCCTTCTTCTTAGCACCACA | 1497.9 | 340.2 | 6.3 × 10−140 | 2.1 | MHC II Ag presentation |
| TMSB10 | Thymosin beta 10 | CATGGGGGAAATCGCCAGCTTCGATA | 3314.6 | 1650.4 | 1.8 × 10−104 | 1.0 | Organization of the cytoskeleton; cell motility, differentiation |
| SECTM1 | Secreted and transmembrane 1 | CATGACTCGAATATCTGAAATGAAGA | 1756.7 | 803.6 | 3.5 × 10−67 | 1.1 | Hematopoietic and/or immune system processes |
| FAU | Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed | CATGGTTCCCTGGCCCGTGCTGGAAA | 1384.8 | 566.0 | 2.7 ×10−65 | 1.3 | Fusion protein (ubiquitin-like protein fubi and ribosomal protein S30) |
| CPVL | Carboxypeptidase, vitellogenic-like | CATGATTAATCGATTCATTTATGGAA | 470.5 | 57.9 | 5.1 × 10−65 | 3.0 | Processing of phagocytosed particles, inflammatory protease cascade |
| PPIA | Peptidylprolyl isomerase A (cyclophilin A) | CATGCCTAGCTGGATTGCAGAGTTAA | 1817.5 | 900.2 | 8.7 × 10−59 | 1.0 | Accelerate the folding of proteins; formation of infectious HIV virions |
| CD14 | CD14 molecule | CATGTGGTCCAGCGCCCTGAACTCCC | 406.2 | 56.4 | 3.0 × 10−53 | 2.8 | Mediate the innate immune response to bacterial lipopolysaccharide |
| S100A10 | S100 calcium-binding protein A10 | CATGAGCAGATCAGGACACTTAGCAA | 813.2 | 277.8 | 1.4 × 10−50 | 1.5 | Cell-cycle progression and differentiation; exo- and endocytosis |
| FOS | FBJ murine osteosarcoma viral oncogene homolog | CATGTGGAAAGTGAATTTGAATGAAA | 287.1 | 17.8 | 2.3 × 10−50 | 4.0 | Forming the TF complex AP-1; proliferation, differentiation |
| TNFAIP2 | TNF α-induced protein 2 | CATGACTCAGCCCGGCTGATGCCTCT | 757.5 | 268.9 | 6.5 × 10−45 | 1.5 | Mediator of inflammation and angiogenesis |
| Top genes up-regulated in nonclassical CD14+CD16++ monocytes compared to intermediate CD14++CD16+ monocytes | |||||||
| CFL1 | Cofilin 1 | CATGGAAGCAGGACCAGTAAGGGACC | 2871.6 | 6395.0 | 1.8 × 10−266 | −1.2 | Actin dynamics; cell motility |
| IFITM2 | IFN-induced transmembrane protein 2 (1-8D) | CATGACCATTCTGCTCATCATCATCC | 1727.6 | 4362.8 | 3.7 × 10−230 | −1.3 | Immune response |
| GNAI2 | Guanine nucleotide-binding protein (G protein), α inhibiting activity polypeptide 2 | CATGTTTTATGGAATTGTTCACCTGG | 1270.8 | 3523.6 | 5.1 × 10−216 | −1.5 | Regulation of adenylate cyclase |
| NPC2 | Niemann-Pick disease, type C2 | CATGTCTCTTTTTCTGTCTTAGGTGG | 1286.2 | 3394.3 | 6.4 × 10−193 | −1.4 | Transport regulation of cholesterol through endosomal/lysosomal system |
| MYL6 | Myosin, light chain 6, alkali, smooth muscle and non-muscle | CATGGTGCTGAATGGCTGAGGACCTT | 2431.1 | 4885.7 | 6.2 × 10−163 | −1.0 | Regulatory light chain of myosin |
| CDKN1C | Cyclin-dependent kinase inhibitor 1C (p57, Kip2) | CATGCCCATCTAGCTTGCAGTCTCTT | 948.6 | 2611.5 | 6.2 × 10−159 | −1.5 | Negative regulator of cell proliferation |
| LYN | v-yes-1 Yamaguchi sarcoma viral-related oncogene homolog | CATGATGTGTTTCACTTATGCTGTTG | 1000.9 | 2602.6 | 6.2 × 10−145 | −1.4 | Cell proliferation, migration |
| LAPTM5 | Lysosomal protein transmembrane 5 | CATGGCGGTTGTGGCAGCTGGGGAGG | 1866.4 | 3905.3 | 2.4 × 10−143 | −1.1 | Transmembrane receptor associated with lysosomes |
| OAZ1 | Ornithine decarboxylase antizyme 1 | CATGTTGTAATCGTGCAAATAAACGC | 2649.6 | 4934.8 | 1.4 × 10−135 | −0.9 | Regulation of polyamine biosynthesis |
| HLA-B | MHC, class I, B | CATGCTGACCTGTGTTTCCTCCCCAG | 4623.1 | 7133.3 | 2.6 × 10−104 | −0.6 | HLA class I heavy chain paralogue; Ag presentation |
| B2M | β2-microglobulin | CATGGTTGTGGTTAATCTGGTTTATT | 6510.0 | 9267.9 | 2.0 × 10−93 | −0.5 | Association with the MHC I heavy chain |
| STK10 | Serine/threonine kinase 10 | CATGGCAGAAGCACAGGTTCTGTACC | 359.1 | 1137.9 | 3.4 × 10−85 | −1.7 | Cell-cycle progression; involved in MAPKK1 pathway |
| PSAP | Prosaposin | CATGAAGTTGCTATTAAATGGACTTC | 6670.3 | 9190.7 | 9.0 × 10−78 | −0.5 | Catabolism of glycosphingolipids |
| CSTB | Cystatin B (stefin B) | CATGATGAGCTGACCTATTTCTGATC | 424.2 | 1186.9 | 4.5 × 10−75 | −1.5 | Thiol protease; intracellular degradation and turnover of proteins |
| LSP1 | Lymphocyte-specific protein 1 | CATGCAGGATGCTTGATGCTGCGTCC | 1138.0 | 2237.1 | 8.7 × 10−72 | −1.0 | Regulation of motility, adhesion, and transendothelial migration |
P < 10−310 is denoted as 0. Protein function: from Entrez Gene, UniProtKB/Swiss-Prot; most representative 26-hit tags are shown. Fold change: log2(CD14++CD16+/CD14+CD16++ ratio).
TPM indicates tags per million.