Top genes up-regulated in intermediate CD14++CD16+ monocytes compared with classical CD14++CD16− and nonclassical CD14+CD16++ monocytes
| Gene symbol . | Gene title . | Tag sequence . | CD14++CD16− TPM . | CD14++CD16+ TPM . | CD14+CD16++ TPM . | Protein function . |
|---|---|---|---|---|---|---|
| CD74 | CD74 molecule, MHC class II invariant chain | CATGGTTCACATTAGAATAAAAGGTA | 13 822.6 | 29 701.2 | 13 635.1 | MHC II Ag processing; cell-surface receptor for MIF |
| IFI30 | IFN γ–inducible protein 30 | CATGATCAAGAATCCTGCTCCACTAA | 2864.6 | 5212.8 | 2085.9 | MHC II Ag processing |
| HLA-DPB1 | MHC class II, DP β 1 | CATGTTCCCTTCTTCTTAGCACCACA | 404.4 | 1470.6 | 334.8 | MHC II Ag presentation |
| HLA-DRA | MHC class II, DR α | CATGGGGCATCTCTTGTGTACTTATT | 5090.7 | 7419.6 | 2566.3 | MHC II Ag presentation |
| SECTM1 | Secreted and transmembrane 1 | CATGACTCGAATATCTGAAATGAAGA | 614.0 | 1722.8 | 787.5 | Hematopoietic and/or immune system processes |
| AIF1 | Allograft inflammatory factor 1 | CATGTCCCTGAAACGAATGCTGGAGA | 733.4 | 2150.5 | 1362.5 | RAC signaling; proliferation; migration; vascular inflammation |
| FAU | Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed | CATGGTTCCCTGGCCCGTGCTGGAAA | 606.0 | 1358.0 | 554.6 | Fusion protein (ubiquitin-like protein fubi and ribosomal protein S30) |
| TMSB10 | Thymosin β 10 | CATGGGGGAAATCGCCAGCTTCGATA | 2257.8 | 3253.1 | 1618.7 | Organization of the cytoskeleton; cell motility, differentiation |
| PPIA | Peptidylprolyl isomerase A (cyclophilin A) | CATGCCTAGCTGGATTGCAGAGTTAA | 1058.3 | 1782.4 | 882.1 | Accelerate the folding of proteins; formation of infectious HIV virions |
| PTPN6 | Protein tyrosine phosphatase, nonreceptor type 6 | CATGCCTCAGCCCTGACCCTGTGGAA | 264.8 | 892.5 | 522.6 | Regulation of cell growth, differentiation, mitotic cycle |
| TGFB1 | TGF β 1 | CATGGGGGCTGTATTTAAGGACACCC | 170.9 | 569.8 | 263.5 | Regulation of proliferation, differentiation, adhesion, migration |
| SAT1 | Spermidine/spermine N1-acetyltransferase 1 | CATGTTTGAAATGAGGTCTGTTTAAA | 866.0 | 1979.1 | 1502.2 | Catalyzes the acetylation of polyamines |
| CAPNS1 | Calpain, small subunit 1 | CATGCCCCAGTTGCTGATCTCTAAAA | 261.4 | 657.2 | 331.9 | Regulatory subunit of nonlysosomal thiol-protease |
| RHOB | ras homolog gene family, member B | CATGCACACAGTTTTGATAAAGGGCA | 55.4 | 355.5 | 164.5 | Intracellular protein trafficking |
| CTSB | Cathepsin B | CATGTGGGTGAGCCAGTGGAACAGCG | 255.9 | 509.3 | 179.0 | Degradation and turnover of proteins; maturation MHC II complex |
| Gene symbol . | Gene title . | Tag sequence . | CD14++CD16− TPM . | CD14++CD16+ TPM . | CD14+CD16++ TPM . | Protein function . |
|---|---|---|---|---|---|---|
| CD74 | CD74 molecule, MHC class II invariant chain | CATGGTTCACATTAGAATAAAAGGTA | 13 822.6 | 29 701.2 | 13 635.1 | MHC II Ag processing; cell-surface receptor for MIF |
| IFI30 | IFN γ–inducible protein 30 | CATGATCAAGAATCCTGCTCCACTAA | 2864.6 | 5212.8 | 2085.9 | MHC II Ag processing |
| HLA-DPB1 | MHC class II, DP β 1 | CATGTTCCCTTCTTCTTAGCACCACA | 404.4 | 1470.6 | 334.8 | MHC II Ag presentation |
| HLA-DRA | MHC class II, DR α | CATGGGGCATCTCTTGTGTACTTATT | 5090.7 | 7419.6 | 2566.3 | MHC II Ag presentation |
| SECTM1 | Secreted and transmembrane 1 | CATGACTCGAATATCTGAAATGAAGA | 614.0 | 1722.8 | 787.5 | Hematopoietic and/or immune system processes |
| AIF1 | Allograft inflammatory factor 1 | CATGTCCCTGAAACGAATGCTGGAGA | 733.4 | 2150.5 | 1362.5 | RAC signaling; proliferation; migration; vascular inflammation |
| FAU | Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed | CATGGTTCCCTGGCCCGTGCTGGAAA | 606.0 | 1358.0 | 554.6 | Fusion protein (ubiquitin-like protein fubi and ribosomal protein S30) |
| TMSB10 | Thymosin β 10 | CATGGGGGAAATCGCCAGCTTCGATA | 2257.8 | 3253.1 | 1618.7 | Organization of the cytoskeleton; cell motility, differentiation |
| PPIA | Peptidylprolyl isomerase A (cyclophilin A) | CATGCCTAGCTGGATTGCAGAGTTAA | 1058.3 | 1782.4 | 882.1 | Accelerate the folding of proteins; formation of infectious HIV virions |
| PTPN6 | Protein tyrosine phosphatase, nonreceptor type 6 | CATGCCTCAGCCCTGACCCTGTGGAA | 264.8 | 892.5 | 522.6 | Regulation of cell growth, differentiation, mitotic cycle |
| TGFB1 | TGF β 1 | CATGGGGGCTGTATTTAAGGACACCC | 170.9 | 569.8 | 263.5 | Regulation of proliferation, differentiation, adhesion, migration |
| SAT1 | Spermidine/spermine N1-acetyltransferase 1 | CATGTTTGAAATGAGGTCTGTTTAAA | 866.0 | 1979.1 | 1502.2 | Catalyzes the acetylation of polyamines |
| CAPNS1 | Calpain, small subunit 1 | CATGCCCCAGTTGCTGATCTCTAAAA | 261.4 | 657.2 | 331.9 | Regulatory subunit of nonlysosomal thiol-protease |
| RHOB | ras homolog gene family, member B | CATGCACACAGTTTTGATAAAGGGCA | 55.4 | 355.5 | 164.5 | Intracellular protein trafficking |
| CTSB | Cathepsin B | CATGTGGGTGAGCCAGTGGAACAGCG | 255.9 | 509.3 | 179.0 | Degradation and turnover of proteins; maturation MHC II complex |
Protein function: from Entrez Gene, UniProtKB/Swiss-Prot; most representative 26-hit tags are shown.
TPM indicates tags per million.