Table 1.

Sequence of Primers Used in the PCRs

Primer Sequence (5′ → 3′)*Position (nt)-151
AATGCCACCCTTGCTGG (sense)  820-836  
B  AATGCCACCCTTGCTGA (sense)  820-836  
C  GCAATGCTCCCAATAATCA (antisense) 908-890  
D  gattacgaattcAATGCCACCCTTG (sense)  820-832 
X  GCCTCTGTCCTTTGCCAC (sense)  −22 to −5  
TGGTCACCATGTCCATGGAA (antisense)  1,262-1,243 
Primer Sequence (5′ → 3′)*Position (nt)-151
AATGCCACCCTTGCTGG (sense)  820-836  
B  AATGCCACCCTTGCTGA (sense)  820-836  
C  GCAATGCTCCCAATAATCA (antisense) 908-890  
D  gattacgaattcAATGCCACCCTTG (sense)  820-832 
X  GCCTCTGTCCTTTGCCAC (sense)  −22 to −5  
TGGTCACCATGTCCATGGAA (antisense)  1,262-1,243 

*Coding sequence is in capitals; lowercase letters indicate a 12-base extension tail.

F0-151

nt + 1 is taken as the first nt of the translation initiation codon.

or Create an Account

Close Modal
Close Modal