Primer sequences used
| Gene . | Accession no. . | Forward primer . | Position . | Reverse primer . | Position . |
|---|---|---|---|---|---|
| hAChE-S | NM_000665 | cttcctccccaaattgctc | 1789-1807 | tcctgcttgctgtagtggtc | 1901-1920 |
| hAChE-R | AY750146 | cttcctccccaaattgctc | 7092-7110 | ggggagaagagaggggttac | 7177-7196 |
| hAChE-common | NM_000665 | gcgatactgggccaactt | 1617-1635 | cgcaggtccagactaacgta | 1717-1737 |
| Actin | NM_001101 | cactcttccagccttccttc | 1079-1099 | ggatgtccacgtcacacttc | 1127-1147 |
| Gene . | Accession no. . | Forward primer . | Position . | Reverse primer . | Position . |
|---|---|---|---|---|---|
| hAChE-S | NM_000665 | cttcctccccaaattgctc | 1789-1807 | tcctgcttgctgtagtggtc | 1901-1920 |
| hAChE-R | AY750146 | cttcctccccaaattgctc | 7092-7110 | ggggagaagagaggggttac | 7177-7196 |
| hAChE-common | NM_000665 | gcgatactgggccaactt | 1617-1635 | cgcaggtccagactaacgta | 1717-1737 |
| Actin | NM_001101 | cactcttccagccttccttc | 1079-1099 | ggatgtccacgtcacacttc | 1127-1147 |
Shown are the transcripts that were quantified by RT-PCR, their GeneBank accession numbers, the forward and reverse primer sequences, and the number of nucleotide positions on the noted transcripts.