Table 1

Primer sequences used

GeneAccession no.Forward primerPositionReverse primerPosition
hAChE-S NM_000665 cttcctccccaaattgctc 1789-1807 tcctgcttgctgtagtggtc 1901-1920 
hAChE-R AY750146 cttcctccccaaattgctc 7092-7110 ggggagaagagaggggttac 7177-7196 
hAChE-common NM_000665 gcgatactgggccaactt 1617-1635 cgcaggtccagactaacgta 1717-1737 
Actin NM_001101 cactcttccagccttccttc 1079-1099 ggatgtccacgtcacacttc 1127-1147 
GeneAccession no.Forward primerPositionReverse primerPosition
hAChE-S NM_000665 cttcctccccaaattgctc 1789-1807 tcctgcttgctgtagtggtc 1901-1920 
hAChE-R AY750146 cttcctccccaaattgctc 7092-7110 ggggagaagagaggggttac 7177-7196 
hAChE-common NM_000665 gcgatactgggccaactt 1617-1635 cgcaggtccagactaacgta 1717-1737 
Actin NM_001101 cactcttccagccttccttc 1079-1099 ggatgtccacgtcacacttc 1127-1147 

Shown are the transcripts that were quantified by RT-PCR, their GeneBank accession numbers, the forward and reverse primer sequences, and the number of nucleotide positions on the noted transcripts.

or Create an Account

Close Modal
Close Modal