Table 1

Clinical features and mutation characteristics in TAM patients with GATA1 mutations

Patient No.SexWBC, ×109/LOutcomeGATA1 mutation*Consequence of mutationMutation type
113,24  F 63.9 CR 207 C>G Tyr69stop PTC 1-3′ 
213  F 89.0 Early death 199 G>T Glu67stop PTC 1-3′ 
313  F NA NA 174 ins 19 bp CAGCCACCGCTGCAGCTGC Frame shift at codon58, stop at codon 73 PTC 1-3′ 
413  F 128.8 CR IVS1 to IVS2 del 1415 bp Splice mutant Splicing error 
513  F NA NA 49 C>T Gln17stop PTC 1-5′ 
613  F 248.6 NA Loss of 2nd exon Splice mutant Splicing error 
713  F 31.2 CR Loss of 2nd exon Splice mutant Splicing error 
813  M 199.6 CR −11 to +33 del 44 bp No translation from Met1 Loss of 1st Met 
913  M 44.9 Early death 45 ins C Frame shift at codon15, stop at codon 39 PTC 1-5′ 
1013  M 50.9 CR 37 G>T Glu13stop PTC 1-5′ 
1113  F 103.0 Early death 90-91 del AG Frame shift at codon 30, stop at codon 38 PTC 1-5′ 
1213  F 14.6 Evolved to ML-DS 116 del A Frame shift at codon 39, stop at codon 136 PTC 2 
1313  M 423.0 CR 185 ins 22 bp GCTGCAGCTGCGGCACTGGCCT Frame shift at codon 62, stop at codon 74 PTC 1-3′ 
1413  M 201.2 CR 189 C>A Tyr63stop PTC 1-3′ 
1513  M NA NA 1 A>G No translation from Met1 Loss of 1st Met 
1613  F 28.3 CR 189 C>A Tyr63stop PTC 1-3′ 
1713  M 203.0 Evolved to ML-DS 38-39 del AG Frame shift at codon 13, stop at codon 38 PTC 1-5′ 
1813  M 31.3 CR 189 C>A Tyr63stop PTC 1-3′ 
1913  M NA NA 90-91 del AG Frame shift at codon 30, stop at codon 38 PTC 1-5′ 
2013  F 114.0 Early death 187 ins T Frame shift at codon 63, stop at codon 67 PTC 1-3′ 
2125  F 26.0 Evolved to ML-DS 194 ins 20 bp GGCACTGGCCTACTACAGGG Frame shift at codon 65, stop at codon 143 PTC 2 
2225  F 25.0 Evolved to ML-DS 194 ins 20 bp GGCACTGGCCTACTACAGGG Frame shift at codon 65, stop at codon 143 PTC 2 
23 F 49.9 CR 3 G>T No translation from Met1 Loss of 1st Met 
24 F 46.2 NA IVS1 3′ boundary AG>AA Splice mutant Splicing error 
25 F 10.5 CR 194 ins 19 bp GCACTGGCCTACTACAGGG Frame shift at codon 65, stop at codon 73 PTC 1-3′ 
2624  F 244.0 Evolved to ML-DS 1 A>G No translation from Met1 Loss of 1st Met 
27 F 38.3 CR Loss of 2nd Exon Splice mutant Splicing error 
2824  F 34.6 CR IVS1 to exon2 del 148 bp Splice mutant Splicing error 
29 M 25.9 Evolved to ML-DS 160 ins TC Frame shift at codon 54, stop at codon 137 PTC 2 
30 F 52.3 Evolved to ML-DS 187 ins CCTAC Frame shift at codon 63, stop at codon 138 PTC 2 
3124  F 221.0 CR 183-193 del 11 bp CTACTACAGGG Frame shift at codon 62, stop at codon 63 PTC 1-3′ 
32 M 149.7 CR 2 T>G No translation from Met1 Loss of 1st Met 
3324  M 132.3 Evolved to ML-DS 101-108 del 8 bp TCCCCTCT Frame shift at codon 34, stop at codon 36 PTC 1-5′ 
3424  F 220.0 Early death 90-91 del AG Frame shift at codon 30, stop at codon 38 PTC 1-5′ 
3524  M 166.0 Early death IVS2 5′ boundary GT>CT Splice mutant Splicing error 
3624  M 57.6 Early death 193-199 GACGCTG>TAGTAGT Asp65stop PTC 1-3′ 
3724  M 247.6 Early death Exon2 to IVS2 del 218 bp Splice mutant Splicing error 
3824  M 93.3 Early death IVS1 3′ boundary AG>AA Splice mutant Splicing error 
3924  M 290.8 Early death 186 ins 12 bp GGCACTGGCCTA Tyr62stop PTC 1-3′ 
40 F 7.8 CR 2 T>C No translation from Met1 Loss of 1st Met 
4124  M 136.6 Early death IVS2 5′ boundary GT>GC Splice mutant Splicing error 
42 M 33.1 Early death 187 ins 8 bp TGGCCTAC Frame shift at codon 63, stop at codon 139 PTC 2 
43 M 9.0 CR 22 ins G Frame shift at codon 8, stop at codon 39 PTC 1-5′ 
44 M 24.1 Evolved to ML-DS 149 ins 20 bp AGCAGCTTCCTCCACTGCCC Frame shift at codon 50, stop at codon 143 PTC 2 
4524  F 53.3 CR 173 C>TGCTGCAGTGTAGTA Frame shift at codon 58, stop at codon 141 PTC 2 
46 F 119.0 CR 1 A>C No translation from Met1 Loss of 1st Met 
47 M 33.0 CR 189 C>A Tyr63stop PTC 1-3′ 
48 M 178.2 Early death 188 ins 22 bp GCAGCTGCGGCACTGGCCTACT Frame shift at codon 63, stop at codon 74 PTC 1-3′ 
49 F 73.6 CR 3 G>A No translation from Met1 Loss of 1st Met 
50 F 12.9 CR 158 ins 7 bp AGCACAG Frame shift at codon 53, stop at codon 69 PTC 1-5′ 
51 M 13.0 CR 154-161 del 8 bp ACAGCCAC Frame shift at codon 52, stop at codon 64 PTC 1-5′ 
52 M 105.5 Early death 4 G>T Glu2stop PTC 1-5′ 
53 F 98.3 CR 4 G>T Glu2stop PTC 1-5′ 
54 F 356.9 CR 219 A>C Splice mutant Splicing error 
55 F 25.8 Evolved to ML-DS 157 ins CA Frame shift at codon 53, stop at codon 137 PTC 2 
56 M 97.4 Evolved to ML-DS 185-188 del 4 bp ACTA Frame shift at codon 62, stop at codon 135 PTC 2 
57 F 97.3 Early death 3 G>A No translation from Met1 Loss of 1st Met 
58 M NA CR 3 G>A No translation from Met1 Loss of 1st Met 
59 M 20.2 CR 150 ins 5 bp TGGCT Frame shift at codon 50, stop at codon 52 PTC 1-5′ 
60 M 133.4 CR 174 ins 19 bp CAAAGCAGCTGCAGCGGTG Frame shift at codon 58, stop at codon 73 PTC 1-3′ 
61 M NA CR 220 G>T Splice mutant Splicing error 
62 M 120.2 CR 220 G>A Splice mutant Splicing error 
63 F 39.0 CR 97-139 del 43 bp Frame shift at codon 33, stop at codon 122 PTC 2 
64 F NA NA 156 ins C Frame shift at codon 52, stop at codon 67 PTC 1-5′ 
65 F 32.4 CR 174 ins 7 bp CTGCAGC Frame shift at codon 58, stop at codon 69 PTC 1-3′ 
66 M 69.4 Early death 174-177 GGCA>TGCGGTGG Frame shift at codon 58, stop at codon 68 PTC 1-3′ 
Patient No.SexWBC, ×109/LOutcomeGATA1 mutation*Consequence of mutationMutation type
113,24  F 63.9 CR 207 C>G Tyr69stop PTC 1-3′ 
213  F 89.0 Early death 199 G>T Glu67stop PTC 1-3′ 
313  F NA NA 174 ins 19 bp CAGCCACCGCTGCAGCTGC Frame shift at codon58, stop at codon 73 PTC 1-3′ 
413  F 128.8 CR IVS1 to IVS2 del 1415 bp Splice mutant Splicing error 
513  F NA NA 49 C>T Gln17stop PTC 1-5′ 
613  F 248.6 NA Loss of 2nd exon Splice mutant Splicing error 
713  F 31.2 CR Loss of 2nd exon Splice mutant Splicing error 
813  M 199.6 CR −11 to +33 del 44 bp No translation from Met1 Loss of 1st Met 
913  M 44.9 Early death 45 ins C Frame shift at codon15, stop at codon 39 PTC 1-5′ 
1013  M 50.9 CR 37 G>T Glu13stop PTC 1-5′ 
1113  F 103.0 Early death 90-91 del AG Frame shift at codon 30, stop at codon 38 PTC 1-5′ 
1213  F 14.6 Evolved to ML-DS 116 del A Frame shift at codon 39, stop at codon 136 PTC 2 
1313  M 423.0 CR 185 ins 22 bp GCTGCAGCTGCGGCACTGGCCT Frame shift at codon 62, stop at codon 74 PTC 1-3′ 
1413  M 201.2 CR 189 C>A Tyr63stop PTC 1-3′ 
1513  M NA NA 1 A>G No translation from Met1 Loss of 1st Met 
1613  F 28.3 CR 189 C>A Tyr63stop PTC 1-3′ 
1713  M 203.0 Evolved to ML-DS 38-39 del AG Frame shift at codon 13, stop at codon 38 PTC 1-5′ 
1813  M 31.3 CR 189 C>A Tyr63stop PTC 1-3′ 
1913  M NA NA 90-91 del AG Frame shift at codon 30, stop at codon 38 PTC 1-5′ 
2013  F 114.0 Early death 187 ins T Frame shift at codon 63, stop at codon 67 PTC 1-3′ 
2125  F 26.0 Evolved to ML-DS 194 ins 20 bp GGCACTGGCCTACTACAGGG Frame shift at codon 65, stop at codon 143 PTC 2 
2225  F 25.0 Evolved to ML-DS 194 ins 20 bp GGCACTGGCCTACTACAGGG Frame shift at codon 65, stop at codon 143 PTC 2 
23 F 49.9 CR 3 G>T No translation from Met1 Loss of 1st Met 
24 F 46.2 NA IVS1 3′ boundary AG>AA Splice mutant Splicing error 
25 F 10.5 CR 194 ins 19 bp GCACTGGCCTACTACAGGG Frame shift at codon 65, stop at codon 73 PTC 1-3′ 
2624  F 244.0 Evolved to ML-DS 1 A>G No translation from Met1 Loss of 1st Met 
27 F 38.3 CR Loss of 2nd Exon Splice mutant Splicing error 
2824  F 34.6 CR IVS1 to exon2 del 148 bp Splice mutant Splicing error 
29 M 25.9 Evolved to ML-DS 160 ins TC Frame shift at codon 54, stop at codon 137 PTC 2 
30 F 52.3 Evolved to ML-DS 187 ins CCTAC Frame shift at codon 63, stop at codon 138 PTC 2 
3124  F 221.0 CR 183-193 del 11 bp CTACTACAGGG Frame shift at codon 62, stop at codon 63 PTC 1-3′ 
32 M 149.7 CR 2 T>G No translation from Met1 Loss of 1st Met 
3324  M 132.3 Evolved to ML-DS 101-108 del 8 bp TCCCCTCT Frame shift at codon 34, stop at codon 36 PTC 1-5′ 
3424  F 220.0 Early death 90-91 del AG Frame shift at codon 30, stop at codon 38 PTC 1-5′ 
3524  M 166.0 Early death IVS2 5′ boundary GT>CT Splice mutant Splicing error 
3624  M 57.6 Early death 193-199 GACGCTG>TAGTAGT Asp65stop PTC 1-3′ 
3724  M 247.6 Early death Exon2 to IVS2 del 218 bp Splice mutant Splicing error 
3824  M 93.3 Early death IVS1 3′ boundary AG>AA Splice mutant Splicing error 
3924  M 290.8 Early death 186 ins 12 bp GGCACTGGCCTA Tyr62stop PTC 1-3′ 
40 F 7.8 CR 2 T>C No translation from Met1 Loss of 1st Met 
4124  M 136.6 Early death IVS2 5′ boundary GT>GC Splice mutant Splicing error 
42 M 33.1 Early death 187 ins 8 bp TGGCCTAC Frame shift at codon 63, stop at codon 139 PTC 2 
43 M 9.0 CR 22 ins G Frame shift at codon 8, stop at codon 39 PTC 1-5′ 
44 M 24.1 Evolved to ML-DS 149 ins 20 bp AGCAGCTTCCTCCACTGCCC Frame shift at codon 50, stop at codon 143 PTC 2 
4524  F 53.3 CR 173 C>TGCTGCAGTGTAGTA Frame shift at codon 58, stop at codon 141 PTC 2 
46 F 119.0 CR 1 A>C No translation from Met1 Loss of 1st Met 
47 M 33.0 CR 189 C>A Tyr63stop PTC 1-3′ 
48 M 178.2 Early death 188 ins 22 bp GCAGCTGCGGCACTGGCCTACT Frame shift at codon 63, stop at codon 74 PTC 1-3′ 
49 F 73.6 CR 3 G>A No translation from Met1 Loss of 1st Met 
50 F 12.9 CR 158 ins 7 bp AGCACAG Frame shift at codon 53, stop at codon 69 PTC 1-5′ 
51 M 13.0 CR 154-161 del 8 bp ACAGCCAC Frame shift at codon 52, stop at codon 64 PTC 1-5′ 
52 M 105.5 Early death 4 G>T Glu2stop PTC 1-5′ 
53 F 98.3 CR 4 G>T Glu2stop PTC 1-5′ 
54 F 356.9 CR 219 A>C Splice mutant Splicing error 
55 F 25.8 Evolved to ML-DS 157 ins CA Frame shift at codon 53, stop at codon 137 PTC 2 
56 M 97.4 Evolved to ML-DS 185-188 del 4 bp ACTA Frame shift at codon 62, stop at codon 135 PTC 2 
57 F 97.3 Early death 3 G>A No translation from Met1 Loss of 1st Met 
58 M NA CR 3 G>A No translation from Met1 Loss of 1st Met 
59 M 20.2 CR 150 ins 5 bp TGGCT Frame shift at codon 50, stop at codon 52 PTC 1-5′ 
60 M 133.4 CR 174 ins 19 bp CAAAGCAGCTGCAGCGGTG Frame shift at codon 58, stop at codon 73 PTC 1-3′ 
61 M NA CR 220 G>T Splice mutant Splicing error 
62 M 120.2 CR 220 G>A Splice mutant Splicing error 
63 F 39.0 CR 97-139 del 43 bp Frame shift at codon 33, stop at codon 122 PTC 2 
64 F NA NA 156 ins C Frame shift at codon 52, stop at codon 67 PTC 1-5′ 
65 F 32.4 CR 174 ins 7 bp CTGCAGC Frame shift at codon 58, stop at codon 69 PTC 1-3′ 
66 M 69.4 Early death 174-177 GGCA>TGCGGTGG Frame shift at codon 58, stop at codon 68 PTC 1-3′ 

We previously reported the GATA1 mutations of the indicated patients.

F indicates female; M, male; CR, complete remission; NA, not available; and IVS, intervening sequence.

*

For cDNA nucleotide numbering, nucleotide number 1 corresponds to the A of the ATG translation initiation codon in the reference sequence.

View Large
This Feature Is Available To Subscribers Only

or Create an Account

Close Modal
Close Modal