Primers Used
| Name . | Nucleotide Sequence . | Genomic Region . | Position* . | Orientation . | RHD-Specific . |
|---|---|---|---|---|---|
| ra21 | gtgccacttgacttgggact | Intron 2 | 2,823 to 2,842 | Sense | No |
| rb7 | atctctccaagcagacccagcaagc | Exon 7 | 1,022 to 998 | Antisense | No |
| rb11 | tacctttgaattaagcacttcacag | Intron 4 | 161 to 185 | Sense | Yes |
| rb12 | tcctgaacctgctctgtgaagtgc | Intron 4 | 198 to 175 | Antisense | Yes |
| rb13 | ctagagccaaacccacatctcctt | Promoter | −675 to −652 | Sense | No |
| rb15 | ttattggctacttggtgcc | Intron 5 | −612 to −630 | Antisense | No |
| rb20d | tcctggctctccctctct | Intron 2 | −25 to −8 | Sense | Yes |
| rb21 | aggtccctcctccagcac | Intron 3 | 28 to 11 | Antisense | No |
| rb21d | cccaggtccctcctcccagcac | Intron 3 | 32 to 11 | Antisense | No |
| rb22 | gggagattttttcagccag | Intron 4 | 82 to 64 | Antisense | No |
| rb24 | agacctttggagcaggagtg | Intron 4 | −53 to −34 | Sense | No |
| rb25 | agcagggaggatgttacag | Intron 5 | −111 to −93 | Sense | No |
| rb26 | aggggtgggtagggaatatg | Intron 6 | −62 to −43 | Sense | No |
| rb44 | gcttgaaatagaagggaaatgggagg | Intron 7 | ≈3,000 | Antisense | No |
| rb46 | tggcaagaacctggaccttgacttt | Intron 3 | −1,279 to −1,255 | Sense | No |
| rb52 | ccaggttgttaagcattgctgtacc | Intron 7 | ≈−3,300 | Sense | Yes |
| re01 | atagagaggccagcacaa | Promoter | −149 to −132 | Sense | Yes |
| re02 | tgtaactatgaggagtcag | Promoter | −572 to −554 | Sense | Yes |
| re11d | agaagatgggggaatctttttcct | Intron 1 | 129 to 106 | Antisense | No |
| re12d | attagccgggcacggtggca | Intron 1 | −1,188 to −1,168 | Sense | Yes |
| re13 | actctaatttcataccaccc | Intron 1 | −72 to −53 | Sense | No |
| re23 | aaaggatgcaggaggaatgtaggc | Intron 2 | 251 to 227 | Antisense | No |
| re31 | tgatgaccatcctcaggt | Exon 3 | 472 to 455 | Antisense | Yes |
| re617 | tctcagctcactgcaacctc | Intron 6 | 1,998 to 2,017 | Sense | No |
| re621 | catccccctttggtggcc | Intron 6 | −102 to −85 | Sense | Yes |
| re71 | acccagcaagctgaagttgtagcc | Exon 7 | 1,008 to 985 | Antisense | Yes |
| re73 | cctttttgtccctgatgacc | Intron 7 | −67 to −48 | Sense | No |
| re74 | tatccatgaggtgctgggaac | Intron 7 | ≈−200 | Sense | No |
| re75 | aaggtaggggctggacag | Intron 7 | ≈120 | Antisense | Yes |
| re82 | aaaaatcctgtgctccaaac | Intron 8 | ≈−45 | Sense | Yes |
| re83 | gagattaaaaatcctgtgctcca | Intron 8 | ≈−50 | Sense | No |
| re91 | caagagatcaagccaaaatcagt | Intron 9 | ≈−40 | Sense | No |
| re93 | cacccgcatgtcagactatttggc | Intron 9 | ≈300 | Antisense | No |
| rf51 | caaaaacccattcttcccg | Intron 5 | −332 to −314 | Sense | No |
| rg62 | tgtattccaggcagaaggc | Intron 6 | 1,736 to 1,755 | Sense | No |
| rh5 | gcacagagacggacacag | 5′ UTR† | −19 to −2 | Sense | No |
| rh7 | acgtacaaatgcaggcaac | 3′ UTR | 1,330 to 1,313 | Antisense | No |
| rr1 | tgttggagagaggggtgatg | 5′ UTR | −60 to −41 | Sense | No |
| rr3 | cagtctgttgtttaccagatg | 3′ UTR | 1,512 to 1,492 | Antisense | Yes |
| rr4 | agcttactggatgaccacca | 3′ UTR | 1,541 to 1,522 | Antisense | Yes |
| Name . | Nucleotide Sequence . | Genomic Region . | Position* . | Orientation . | RHD-Specific . |
|---|---|---|---|---|---|
| ra21 | gtgccacttgacttgggact | Intron 2 | 2,823 to 2,842 | Sense | No |
| rb7 | atctctccaagcagacccagcaagc | Exon 7 | 1,022 to 998 | Antisense | No |
| rb11 | tacctttgaattaagcacttcacag | Intron 4 | 161 to 185 | Sense | Yes |
| rb12 | tcctgaacctgctctgtgaagtgc | Intron 4 | 198 to 175 | Antisense | Yes |
| rb13 | ctagagccaaacccacatctcctt | Promoter | −675 to −652 | Sense | No |
| rb15 | ttattggctacttggtgcc | Intron 5 | −612 to −630 | Antisense | No |
| rb20d | tcctggctctccctctct | Intron 2 | −25 to −8 | Sense | Yes |
| rb21 | aggtccctcctccagcac | Intron 3 | 28 to 11 | Antisense | No |
| rb21d | cccaggtccctcctcccagcac | Intron 3 | 32 to 11 | Antisense | No |
| rb22 | gggagattttttcagccag | Intron 4 | 82 to 64 | Antisense | No |
| rb24 | agacctttggagcaggagtg | Intron 4 | −53 to −34 | Sense | No |
| rb25 | agcagggaggatgttacag | Intron 5 | −111 to −93 | Sense | No |
| rb26 | aggggtgggtagggaatatg | Intron 6 | −62 to −43 | Sense | No |
| rb44 | gcttgaaatagaagggaaatgggagg | Intron 7 | ≈3,000 | Antisense | No |
| rb46 | tggcaagaacctggaccttgacttt | Intron 3 | −1,279 to −1,255 | Sense | No |
| rb52 | ccaggttgttaagcattgctgtacc | Intron 7 | ≈−3,300 | Sense | Yes |
| re01 | atagagaggccagcacaa | Promoter | −149 to −132 | Sense | Yes |
| re02 | tgtaactatgaggagtcag | Promoter | −572 to −554 | Sense | Yes |
| re11d | agaagatgggggaatctttttcct | Intron 1 | 129 to 106 | Antisense | No |
| re12d | attagccgggcacggtggca | Intron 1 | −1,188 to −1,168 | Sense | Yes |
| re13 | actctaatttcataccaccc | Intron 1 | −72 to −53 | Sense | No |
| re23 | aaaggatgcaggaggaatgtaggc | Intron 2 | 251 to 227 | Antisense | No |
| re31 | tgatgaccatcctcaggt | Exon 3 | 472 to 455 | Antisense | Yes |
| re617 | tctcagctcactgcaacctc | Intron 6 | 1,998 to 2,017 | Sense | No |
| re621 | catccccctttggtggcc | Intron 6 | −102 to −85 | Sense | Yes |
| re71 | acccagcaagctgaagttgtagcc | Exon 7 | 1,008 to 985 | Antisense | Yes |
| re73 | cctttttgtccctgatgacc | Intron 7 | −67 to −48 | Sense | No |
| re74 | tatccatgaggtgctgggaac | Intron 7 | ≈−200 | Sense | No |
| re75 | aaggtaggggctggacag | Intron 7 | ≈120 | Antisense | Yes |
| re82 | aaaaatcctgtgctccaaac | Intron 8 | ≈−45 | Sense | Yes |
| re83 | gagattaaaaatcctgtgctcca | Intron 8 | ≈−50 | Sense | No |
| re91 | caagagatcaagccaaaatcagt | Intron 9 | ≈−40 | Sense | No |
| re93 | cacccgcatgtcagactatttggc | Intron 9 | ≈300 | Antisense | No |
| rf51 | caaaaacccattcttcccg | Intron 5 | −332 to −314 | Sense | No |
| rg62 | tgtattccaggcagaaggc | Intron 6 | 1,736 to 1,755 | Sense | No |
| rh5 | gcacagagacggacacag | 5′ UTR† | −19 to −2 | Sense | No |
| rh7 | acgtacaaatgcaggcaac | 3′ UTR | 1,330 to 1,313 | Antisense | No |
| rr1 | tgttggagagaggggtgatg | 5′ UTR | −60 to −41 | Sense | No |
| rr3 | cagtctgttgtttaccagatg | 3′ UTR | 1,512 to 1,492 | Antisense | Yes |
| rr4 | agcttactggatgaccacca | 3′ UTR | 1,541 to 1,522 | Antisense | Yes |
The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons, or relative to their adjacent exon/intron boundaries for all other primers. Primers ra2160 and rh561 were reported previously.
5′ UTR: 5′ untranslated region of exon 1; 3′ UTR: 3′ untranslated region of exon 10.