PCR Characterization of the 1109A → T Mutation
| . | PCR Amplification Primers . | Fragment Size (bp) . | Alu I Digest Normal Pattern (bp) . | Alu I Digest Mutant Pattern . |
|---|---|---|---|---|
| Sense Antisense | 5′GACACTCCCGCAGTGTCCGC3′ 5′GACTCATTAGCATCATCCAGG3′ | 282 | 178,62,32,10 | 101,77,62,32,10 |
| . | PCR Amplification Primers . | Fragment Size (bp) . | Alu I Digest Normal Pattern (bp) . | Alu I Digest Mutant Pattern . |
|---|---|---|---|---|
| Sense Antisense | 5′GACACTCCCGCAGTGTCCGC3′ 5′GACTCATTAGCATCATCCAGG3′ | 282 | 178,62,32,10 | 101,77,62,32,10 |