TCR and IgH gene rearrangements in case 1
. | Development of Burkitt lymphoma, Feb 1996 . | Burkitt lymphoma remission after chemotherapy, Dec 1998 . | Development of LyP, Aug 2000 . | Development of ALCL, Dec 2000 . |
|---|---|---|---|---|
| IgH-VDJ rearrangement in bone marrow* | Present* | Absent* | Absent* | ND |
| TCR-γ gene rearrangement | ||||
| Bone marrow | Biallelic (V2/4-J1/2 and V9-J1/2)*† | Biallelic (V2/4-J1/2 and V9-J1/2)* | Biallelic (V2/4-J1/2 and V9-J1/2)*† | ND |
| Peripheral blood | ND | ND | Biallelic (V2/4-J1/2 and V9-J1/2)* | ND |
| Skin lesions | NA | NA | Biallelic (V2/4-J1/2‡ and V9-J1/2§∥ (lesions of LyP) | Biallelic (V2/4-J1/2† and V9-J1/2§∥ (lesions of ALCL) |
. | Development of Burkitt lymphoma, Feb 1996 . | Burkitt lymphoma remission after chemotherapy, Dec 1998 . | Development of LyP, Aug 2000 . | Development of ALCL, Dec 2000 . |
|---|---|---|---|---|
| IgH-VDJ rearrangement in bone marrow* | Present* | Absent* | Absent* | ND |
| TCR-γ gene rearrangement | ||||
| Bone marrow | Biallelic (V2/4-J1/2 and V9-J1/2)*† | Biallelic (V2/4-J1/2 and V9-J1/2)* | Biallelic (V2/4-J1/2 and V9-J1/2)*† | ND |
| Peripheral blood | ND | ND | Biallelic (V2/4-J1/2 and V9-J1/2)* | ND |
| Skin lesions | NA | NA | Biallelic (V2/4-J1/2‡ and V9-J1/2§∥ (lesions of LyP) | Biallelic (V2/4-J1/2† and V9-J1/2§∥ (lesions of ALCL) |
ND indicates not done; NA, not applicable.
Determined by manual sequence analysis and MRD analysis.
The frequency of bone marrow clone was approximately 8% in comparison with peripheral blood in year 2000.
Sequences for the first allele. V segment: ATTACTGTGCCACCTGGGATG; N-region: CCCCCTTTCCG; J segment: AGAAACTCTTTGG.
Sequences for the second allele: V segment: TACTACTGTGCCTTGTGGGAGG; N-region: TGCTTTAGCCACTGG; J-segment: TTATAAGAAACTCTTTGG.
Determined by PCR and capillary electrophoresis. The sequences were identical with those obtained by manual sequencing of fresh tissue in the samples of the bone marrow, blood, LyP lesions (n = 2) and ALCL lesions (n = 1).