Survival impact of ABCA3 expression in AML. Kaplan-Meier curves of LFS in the pediatric exploratory set (A), pediatric validation set (B), pediatric entire dataset (C), and adult entire set (D) as well as restricted to patients treated with chemotherapy only (E) or GO) (F). No at risk, number of patients at risk. Patients with high (red curves) and low (blue curves) ABCA3 expression were separated with the best determined cutoff value of 1.20 AU. Hazard ratios (HR) were computed with 95% confidence intervals (95CI), log-rank P values set on the graphs. Quantitative RT-PCR analysis was carried out with iQ SYBR Green Supermix (Bio-Rad) according to the manufacturer’s instructions using oligonucleotides against exon 6 and 7 of ABCA3 (annotated according to FasterDB database (ABCA3_F: CCTTCAACCACAGCAAGGAG, ABCA3_R: TTGGGAAAAGCGGGAAAAGG). Relative quantification of the E6-E7 fragment of ABCA3 transcripts was performed according to the method described by Pfaffl using GUSb and ABL1 as references (GUSb_F: GCCTGGGTTTTGTGGTCATCTATTC, GUSb_R: CAGTAGCCACTTTCATGCCAACTC, ABL1_F: TGGTAGGGGAGAACCACTTG, and ABL1_R: GGTAGCAATTTCCCAAAGCA). Cycling reactions were performed with a C1000 Touch Thermal Cycler (Bio-Rad) and fluorescence signals measured with a CFX96 Real-Time System (Bio-Rad). Data were processed with CFX Manager software version 3.1 (Bio-Rad). RT-qPCR data were expressed in arbitrary units (AU).