High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black).