Figure 1.
Figure 1. Furin is selectively regulated by IL-12 and Stat4 and is preferentially expressed in Th1 cells. (A) Human T cells were preactivated, rested, and restimulated with cytokines (10 ng/mL, 50 U/mL for IL-2) for 6 hours. Furin and GAPDH mRNA levels were analyzed by real-time PCR. Furin expression was normalized to GAPDH, and unstimulated samples were given an arbitrary value of 1. (B) T cells were treated with IL-12 and the relative expression of different proprotein convertases was analyzed by RT-PCR as in panel A. (C-D) CD4+ T cells from wild-type, Stat4-, or Ifng-deficient mice were stimulated with indicated cytokines for 24 hours, and furin was analyzed by RT-PCR. Furin expression in unstimulated wild-type cells was assigned the value of 1. (E) Murine CD4+ T cells were stimulated with IL-2 or IL-12 for 1 hour as indicated, and Stat4 and Stat5 binding to mouse Fur and Osm promoters was analyzed by chromatin immunoprecipitation. The amount of immunoprecipitated DNA was quantified by quantitative PCR and normalized to the input value, and is expressed as fold-enrichment relative to normal rabbit serum control. Furin primers forward: GAAAGGCTGGCAGGAGAAGA, reverse: TAGCCAGACCCCTGAAGGC, Taqman MGB probe: TGTGCCTGGGTTGC; OSM primers forward: AATTCGAAGAAAACGGGAGGA, reverse: GAACATGACCCCAAAAACCAA, Taqman MGB probe: CCCATTGGCCGCCTG. (F) Naive CD4+/45RO– human T cells were purified using negative selection columns and activated with plate-bound anti-CD3 and anti-CD28 for 3 days in the presence of IL-2 (50 U/mL), IL-12 (10 ng/mL), and anti–IL-4 Ab (5 mg/mL) for Th1 condition or in the presence of IL-2 (50 U/mL), IL-4 (40 ng/mL), and anti–IL-12 Ab (5 mg/mL) for Th2 condition. On day 3, the polarizing cytokines were re-added and the cells were cultured 4 additional days without neutralizing antibodies. Furin, IFN-γ, and IL-4 mRNA expression levels, normalized to GAPDH, are shown with expression in naive cells being assigned an arbitrary value of 1. Furin and actin protein levels from Th1 and Th2 samples were analyzed by Western blot (insert). All experiments were performed at least 3 times. One representative experiment is shown, and error bars depict intraexperimental variation. *P < .001.

Furin is selectively regulated by IL-12 and Stat4 and is preferentially expressed in Th1 cells. (A) Human T cells were preactivated, rested, and restimulated with cytokines (10 ng/mL, 50 U/mL for IL-2) for 6 hours. Furin and GAPDH mRNA levels were analyzed by real-time PCR. Furin expression was normalized to GAPDH, and unstimulated samples were given an arbitrary value of 1. (B) T cells were treated with IL-12 and the relative expression of different proprotein convertases was analyzed by RT-PCR as in panel A. (C-D) CD4+ T cells from wild-type, Stat4-, or Ifng-deficient mice were stimulated with indicated cytokines for 24 hours, and furin was analyzed by RT-PCR. Furin expression in unstimulated wild-type cells was assigned the value of 1. (E) Murine CD4+ T cells were stimulated with IL-2 or IL-12 for 1 hour as indicated, and Stat4 and Stat5 binding to mouse Fur and Osm promoters was analyzed by chromatin immunoprecipitation. The amount of immunoprecipitated DNA was quantified by quantitative PCR and normalized to the input value, and is expressed as fold-enrichment relative to normal rabbit serum control. Furin primers forward: GAAAGGCTGGCAGGAGAAGA, reverse: TAGCCAGACCCCTGAAGGC, Taqman MGB probe: TGTGCCTGGGTTGC; OSM primers forward: AATTCGAAGAAAACGGGAGGA, reverse: GAACATGACCCCAAAAACCAA, Taqman MGB probe: CCCATTGGCCGCCTG. (F) Naive CD4+/45RO– human T cells were purified using negative selection columns and activated with plate-bound anti-CD3 and anti-CD28 for 3 days in the presence of IL-2 (50 U/mL), IL-12 (10 ng/mL), and anti–IL-4 Ab (5 mg/mL) for Th1 condition or in the presence of IL-2 (50 U/mL), IL-4 (40 ng/mL), and anti–IL-12 Ab (5 mg/mL) for Th2 condition. On day 3, the polarizing cytokines were re-added and the cells were cultured 4 additional days without neutralizing antibodies. Furin, IFN-γ, and IL-4 mRNA expression levels, normalized to GAPDH, are shown with expression in naive cells being assigned an arbitrary value of 1. Furin and actin protein levels from Th1 and Th2 samples were analyzed by Western blot (insert). All experiments were performed at least 3 times. One representative experiment is shown, and error bars depict intraexperimental variation. *P < .001.

Close Modal
This Feature Is Available To Subscribers Only

or Create an Account

Close Modal
Close Modal