Furin regulates IFN-γ production. (A) Furin-deficient LoVo cells were transfected with 0.5 μg human IFN-γ cDNA, vector alone, and 1.5 μg furin cDNA. IFN-γ protein was measured by ELISA (top panel) and IFN-γ mRNA expression was normalized to GAPDH (bottom panel), with pcDNA3-transfected cells being given an arbitrary value 1. (B) Human T cells were rested overnight and stimulated with IL-12 with α₁-PDX (8 μM) or α₁-AT as indicated for 16 hours. Shown are IFN-γ protein (top panel) and relative IFN-γ mRNA expression (bottom panel). Unstimulated α₁-AT–treated cells were given an arbitrary value of 1. (C) Human Th1 cells were polarized for 1 week and restimulated with anti-CD3 and anti-CD28 for 24 hours in the presence α₁-PDX or α₁-AT as indicated. IFN-γ secretion is shown in the upper panel. Furin and actin protein levels from the same samples were determined by Western blot (bottom panel). An approximately 90-kDa doublet representing intact furin is identified by the arrow. (D) Human Th1 and Th2 (1 × 10⁶) were prepared as in Figure 1 and were transfected with siRNAfurin (1 μg, sense: GGACUUGGCAGGCAAUUAUUU purchased from Dharmacon, Lafayette, CO) or nonsilencing siRNAs (siRNAns, nontargeting siRNA no. 1 from Dharmacon) using T-cell nucleofector kit (Amaxa; approximately 45% transfection efficiency, detected by green fluorescent protein [GFP]). At 48 hours after transfection, cells were restimulated for 24 hours with anti-CD3 and anti-CD28. IFN-γ and furin mRNA levels were normalized to GAPDH, and Th1 cells transfected with siRNAns were assigned an arbitrary value of 100. IFN-γ and IL-4 proteins were detected from supernatants of Th1 and Th2 cells, respectively, by Cytometric Bead Array. Western blot (top right panel) shows the effect of furin RNAi on furin and actin protein levels in human CD3⁺ cells. All experiments were performed at least 3 times. One representative experiment is shown, and error bars depict intraexperimental variation.