Activation of the IL-9 promoter was mediated by NF-κB and the IL-9 NF-κB motif ATGTCAGGGTTTTTCCGTGTTTG bond to NK-κB in the gel shift assay. (A) Schematic representation of the IL-9 luciferase reporter constructs P1, P2, P3, P4, and P5 (ΔNF-κB). (B) IL-9 luciferase reporter construct P1 (10 μg) and CMV-Renilla (1 μg) were transfected into JPX-9 and JPX-m cells. The Tax expression was induced by addition of CdCl₂, and the promoter activities were assayed at different time points after CdCl₂ addition. The promoter activities were normalized by the Renilla value. The results are representative of 3 independent experiments. (C) 10 μg of the IL-9 luciferase construct and 1 μg CMV-Renilla were transfected into Tax expressing Hut102, MT-1, MT-2, and Tax nonexpressing Jurkat, CEM cells by electroporation. Dual-luciferase assays were performed 48 hours later. Normalized results using Renilla values are representative of 3 independent experiments. Experimental variations are indicated by SE bars. (D) The IL-9 luciferase constructs were transfected into Jurkart and CEM T cells in the absence (pMT2T, empty vector) or in the presence of 10 μg of the Tax expression construct pMT2T-Tax by electroporation. Dual-luciferase assays were performed following the manufacturer's recommendations. The data are representative of 3 independent experiments. (E) Gel shift assay. Extracts obtained from 293T cells transfected with p65 and p50 expression constructs were used for the binding of cNF-κB AGTTTGAGGGGACTTTCCCAGGC and IL-9 NF-κB ATGTCAGGGTTTTTCCGTGTTTG (the underlined sequences are the NF-κB binding sites). The typical p50/p65 heterodimer and p50/p50 homodimer can be readily seen with cNF-κB, whereas IL-9 NF-κB forms a complex that comigrates with the p50/p50 homodimer of the cNF-κB, as shown by an arrow (lanes 2, 6). The binding of cNF-κB to p50/p65 and p50/p50 complexes can be competed off specifically by addition of a 50-fold molar excess of unlabeled IL-9 NF-κB probe (lane 3) but was not affected by addition of a 50-fold molar excess of unlabeled nonspecific SP1 probe (lane 4). Similarly, the binding of IL-9 NF-κB to the p50/p50 complex was specifically competed off by addition of a 50-fold molar excess of unlabeled cNF-κB probe (lane 7) and was not affected by addition of a 50-fold molar excess of unlabeled nonspecific SP1 probe (lane 8). Lanes 1 and 5 represent the negative controls. (F) Gel shift assay. Nuclear extracts from the HTLV-I–positive cell line Hut102 were used for the binding of cNF-κB and IL-9 NF-κB. The patterns of cNF-κB and IL-9 NF-κB binding are very similar to panel E. A vertical line has been inserted to indicate a reposition of gel lanes.