Schematic representation of the targeting vector and resulting modified allele to generate the Jak2^V617F KI mouse model. Homologous recombination into the Jak2 WT allele of mouse embryonic stem (ES) cells resulted into the FLEX (F) or L2 conditional allele. A correctly targeted ES clone was injected into blastocyst stage embryos to generate L2 chimeric mice (WT phenotype). Chimeras were bred with flippase (FLP recombinase) TG mice to remove the FRT-flanked selection PgkNeoR cassette from the progeny. To generate the L- KI offspring, expressing the mutated exon 13 and the resulting JAK2^V617F protein, KI^flex(F)/+ animals were crossed with TG animals expressing the Cre recombinase. Cre recombination induced the LoxP site-directed inversion of a KI construct, resulting in the Lox511-directed excision of the WT exon13 and transcription of the mutated exon13 into the G1849U-mutated mRNA that results into the JAK2^V617F protein translation (KI phenotype). The WT, L2 (FLEX), and L- alleles could be discriminated using PCR analysis with different primers (a, b, c) whose location is represented in the figure. A typical result from tail-DNA genotyping, showing correct heterozygous recombination (L- construct), is shown with the a (TGTCTTACTAAAGCCCAGGTGATGG)/b (GCTCCAGGGTTACACGAGTC) couple of primers resulted into the 105-bp, 186-bp, and 884-bp (the latter not visible with our PCR conditions) PCR-amplified fragments within the WT, L-, and L2 allele, respectively. The c (GTCTGTCCAAAGAGTCTGTAAGTAC)/b couple of primers amplified a fragment (144 bp) only within the L2 allele. ** indicates the Lox511-based inversion can also precede the LoxP-based excision, resulting in an identical KI phenotype.