A mutated JAK2 is overexpressed in a BCP-ALL sample and transforms Ba/F3 cells. (A) Quantitative RT-PCR analysis of JAK2 expression in leukemic samples. Human Taqman sets were located in the 3′ region of the tyrosine kinase domain, conserved in all JAK2 gene rearrangements. JAK2 primers and probes were forward (GTGTTCCATTTGATAGAACTTTTGAAGA), probe (5′-FAM-AGATTACCAAGACCAGATGGATGCCCAGA-TAMRA-3′), and reverse (ATTATTGTTCCAGCATTCTGTCATGA). The quality of the cDNA was evaluated using GUSB expression as described.¹⁶  The relative expression level of tyrosine kinase genes was calculated using the ΔCt calculation. The ratio of gene expression relative to the ubiquitously expressed gene GUSB was calculated for each sample. Two groups of samples are compared: BCP-ALL (n = 26) and AML (n = 61). Three ill-classified acute leukemia samples are not shown. Results are presented as a box plot graph using a logarithmic scale. The boundary of the box closest to zero indicates the 25th percentile, a line within the box marks the median, and the boundary of the box farthest from zero indicates the 75th percentile. Narrow horizontal bars above and below the box indicate the 90th and 10th percentiles. Outliers appear as dots, and the UPN3759 sample is shown. (B) Sequence analysis of the JH2 domain JAK2ΔIREED mutation in the patient with DS with BCP-ALL showing a combined deletion of 16 nucleotides and the addition of 1 nucleotide. Sequence shown was obtained from DNA at diagnosis (Dg; top) and at complete remission (CR; bottom). During remission the sequence was identical to the wild-type JAK2 sequence. (C) The R683 amino acid, deleted in the JAK2 genomic sequence of the UPN3759 sample (gray box), is a conserved residue of the 4 human JAK proteins. (D) The JAK2ΔIREED mutant activates the JAK/STAT pathway. Western blotting analyses of JAK2 and STAT5 proteins in IL-3–dependent control cells or transformed JAK2 Ba/F3 cells. Transduced cells were sorted by flow cytometry for GFP expression and grown in the presence (+) or absence (−) of WEHI-conditioned medium (WCM). Lane 1 corresponds to wild-type Ba/F3 cells starved and stimulated by IL-3. Extraction and Western blotting analyses were performed using standard protocols. Antibodies against phospho-STAT5 (Y694) and phospho-JAK2 (Y1007/Y1008) were from Cell Signaling Technology (Danvers, MA). The JAK2 (C20) antibody was from Santa Cruz Biotechnology (Santa Cruz, CA), the Flag M2 antibody was from Sigma Aldrich (St Louis, MO), and the STAT5 immune serum was previously described.¹⁵  Cell lysates (100 μg) were used. (E) Sorted GFP-positive cells were incubated in media without IL-3 for 7 days, and the numbers of total viable cells were scored. Error bars indicate SDs.