RNAi screening identifies loss of HAP1 in l-asparaginase–resistant ALL cells. (A) Parental SEM leukemic cells (*) infected with shRNA library (Lib; open circles) showed resistance to l-asparaginase compared with cells infected with an empty pRS vector (red circles). Cells were treated with different concentrations of l-asparaginase for 4 days; surviving fractions were quantified by Alamar blue assay. Values are means ± standard error of the mean from 3 independent experiments. (B) Presence of a 642-bp shRNA insert in cells infected with retrovirus carrying the shRNA Lib following the first (puromycin) and second (l-asparaginase) screening. PCR was performed using gDNA as a template and pRS forward (CCCTTGAACCTCCTCGTTCGACC) and reverse (GAGACGTGCTACTTCCATTTGTC) primers. (C) Identification of HAP1 loss in l-asparaginase–resistant cells. l-asparaginase–resistant clones isolated by soft agar colony formation assay were subjected to gDNA isolation and PCR using the primers indicated previously. PCR products (642 bp) containing an shRNA insert resolved in 1% agarose gel were cut, extracted, and sequenced using the pRS-sequence primer GCTGACGTCATCAACCCGCT. The HAP1 target sequence was identified from 3 independent l-asparaginase–resistant clones. (D) HAP1 is expressed in SEM cells as well as C1, MOLT3, TIB202, and POETIC2²³  ALL cells. Cell lysates (80 μg) were resolved by SDS-PAGE and immunoblotted using HAP1 or actin antibody.