Negative-polarity strand HCV RNA and specificity of CAP-based RT-PCR assay. Products were fractionated on a 3% agarose gel and stained with ethidium bromide. Lane B: detection of synthetic HCV negative strand RNA generated from the vector pRTI HCV cDNA containing HCV capsid sequences cloned into pBluescript (Stratagene, San Diego, CA).24 Lanes A, E, and G: negative control reactions in which RNA templates were amplified in the absence of RT, omitting specific primers, or in nucleic acids extracted from CD34⁺ cells of a HCV-negative control, respectively. Lanes C and D: RT-PCR products for negative strand HCV RNA amplified from highly purified samples of CD34⁺ cells from patients no. 5 and 6, respectively. Results were confirmed after Southern blotting (inserted panel). A total of 1 μg of RNA extracts prepared from CD34⁺ cells was used along with 250 ng outer sense primer (5′CCAAAACCCCAAAGAAA3′, position: 750) for cDNA synthesis. Resulting cDNA was amplified after addition of 250 ng of the outer antisense primer (5′GTACCCCATGAGGTCGGCG3′, position: 355). A second PCR reaction was performed using a set of internal primers (sense-5′CAGATCGTTGGTGGAGTT3′, position: 427; antisense-5′CAAGCCCTCATTGCCAT3′, position: 616). The resulting product of 189 bp was probed after Southern blotting using a P³²-labeled oligomer (5′GGTCGCAACCTCGAGGTAGACGTCAGCCT3′, position: 506). Lane F: molecular markers (HaeIII-digested ◊X174). Predicted size of amplified fragment is indicated in base pair (bp).