Fig. 5.
Fig. 5. Induction of Sp1 binding activity to cyclin D3 promoter by Mpl ligand. (A) A DNA fragment that extends from −190 to −99 bp was used in a gel mobility shift assay with nuclear extracts derived from Y10 cells cultured in the absence or presence of MGDF, as detailed in Materials and Methods. The resulting major distinctive protein complexes were indicated as 1, 2a, 2b, and 3. A 50-fold molar excess of unlabeled DNA fragment (−190/−99) or Sp1 consensus oligonucleotides were added as indicated. The sequence of the oligomer containing the Sp1 consensus site (underlined) was 5′ATTCGATCGGGGCGGGGCGAGC3′. Supershift analysis was conducted by incubating the reaction mix with Sp1 or Sp3 antibodies. Similar competition and supershift assays were also performed with nuclear extracts derived from cells not treated with MGDF, yielding data similar to those described in this figure (not shown). The intensities of the bands were quantitated using the Electrophoresis Documentation and Analysis System. (B) The larger DNA fragment spanning the region −190 to −37 (−190/−37wt) was used as a probe for gel mobility shift assay along with nuclear extract derived from Y10 cells treated with MGDF. A 50-fold molar excess of unlabeled −190/−37(Wt) DNA fragment was added as a competitor and a Sp1 antibody was added when indicated. Similar shifts were conducted with probes containing mutations in one (−190/37m1 or −190/37m2) or both (−190/−37m1/m2) of the Sp1 sites at −64 to −72 and −121 to −129, respectively. The nucleotides in each mutated Sp1 site are GGAATGGGG (as compared with GGGGCGGGG in wild-type). The intensities of the bands were quantitated using the Electrophoresis Documentation and Analysis System, indicating a 2.7-fold increase in the extent of Sp1 binding in extracts derived from MGDF-treated cells, as compared with control nontreated cells (not shown). (C) Oligonucleotides spanning the region from −139 to −90, in which the ATF/CREB site at position −103 to −110 was mutated (−139/−90mATF), or oligonucleotides spanning the region from −139 to −90, in which the Sp1 site at −121 to −129 was mutated (−139/−90mSp1), and oligonucleotides extending from −139 to −90 (−139/−90) were used as probes in gel mobility shift assays. The nature of the mutations is described in Materials and Methods. A 50-fold molar excess of unlabeled Sp1 consensus oligonucleotides or 1 μg anti-Sp1 was added as indicated. The intensities of the bands were quantitated using the Electrophoresis Documentation and Analysis System, indicating no significant change in the extent of ETF/CREB binding in extracts derived from MGDF-treated cells, as compared with control nontreated cells (not shown). The data shown are taken from a representative experiment of four performed.

Induction of Sp1 binding activity to cyclin D3 promoter by Mpl ligand. (A) A DNA fragment that extends from −190 to −99 bp was used in a gel mobility shift assay with nuclear extracts derived from Y10 cells cultured in the absence or presence of MGDF, as detailed in Materials and Methods. The resulting major distinctive protein complexes were indicated as 1, 2a, 2b, and 3. A 50-fold molar excess of unlabeled DNA fragment (−190/−99) or Sp1 consensus oligonucleotides were added as indicated. The sequence of the oligomer containing the Sp1 consensus site (underlined) was 5′ATTCGATCGGGGCGGGGCGAGC3′. Supershift analysis was conducted by incubating the reaction mix with Sp1 or Sp3 antibodies. Similar competition and supershift assays were also performed with nuclear extracts derived from cells not treated with MGDF, yielding data similar to those described in this figure (not shown). The intensities of the bands were quantitated using the Electrophoresis Documentation and Analysis System. (B) The larger DNA fragment spanning the region −190 to −37 (−190/−37wt) was used as a probe for gel mobility shift assay along with nuclear extract derived from Y10 cells treated with MGDF. A 50-fold molar excess of unlabeled −190/−37(Wt) DNA fragment was added as a competitor and a Sp1 antibody was added when indicated. Similar shifts were conducted with probes containing mutations in one (−190/37m1 or −190/37m2) or both (−190/−37m1/m2) of the Sp1 sites at −64 to −72 and −121 to −129, respectively. The nucleotides in each mutated Sp1 site are GGAATGGGG (as compared with GGGGCGGGG in wild-type). The intensities of the bands were quantitated using the Electrophoresis Documentation and Analysis System, indicating a 2.7-fold increase in the extent of Sp1 binding in extracts derived from MGDF-treated cells, as compared with control nontreated cells (not shown). (C) Oligonucleotides spanning the region from −139 to −90, in which the ATF/CREB site at position −103 to −110 was mutated (−139/−90mATF), or oligonucleotides spanning the region from −139 to −90, in which the Sp1 site at −121 to −129 was mutated (−139/−90mSp1), and oligonucleotides extending from −139 to −90 (−139/−90) were used as probes in gel mobility shift assays. The nature of the mutations is described in Materials and Methods. A 50-fold molar excess of unlabeled Sp1 consensus oligonucleotides or 1 μg anti-Sp1 was added as indicated. The intensities of the bands were quantitated using the Electrophoresis Documentation and Analysis System, indicating no significant change in the extent of ETF/CREB binding in extracts derived from MGDF-treated cells, as compared with control nontreated cells (not shown). The data shown are taken from a representative experiment of four performed.

Close Modal
This Feature Is Available To Subscribers Only

or Create an Account

Close Modal
Close Modal