![Fig. 2. Analysis of CD16A and CD16B genes expressed in donor 17 by PCR. / (A) Restriction map of CD16B (neutrophils) and CD16A (natural killer [NK] cells). Gene-specific restriction endonuclease sites Dra I (D) and Taq I (T) are indicated in a box. Also shown are the positions of the primers used for PCR amplification of the segment of the exon 5 (corresponding to 611-825 bp of cDNA). (thick bars) Coding regions of cDNA. (thin bars) Noncoding regions of cDNA. (B) Restriction endonuclease analysis of PCR products recovered from donor 17 and control. The exon 5 segment was amplified with primers 1 (forward, gtttggcagtgtcaa) and 2 (reverse, gctcttattactcccatggga) using genomic DNA from control (left panel) and D17 (right panel). The PCR product was treated without (lanes 1 and 3) or with Dra I (lanes 2 and 4) or with Taq I (lanes 3 and 6), and then it was analyzed by 2% NuSieve agarose gel.](https://ash.silverchair-cdn.com/ash/content_public/journal/blood/95/3/10.1182_blood.v95.3.1069.003k14_1069_1077/6/bloo00314002w.jpeg?Expires=1735559229&Signature=ZLOIm3tvobB3w3ZdFbk4okA~nCe0CiDSCYRyMpOugUCdAZShN1ZLKo~7qaREov~ie5mUyu4B3eCNi0e1jen-Em9RYGUzyCMF4ZXKmmxC1oeK-sUhTyFQeyMFvIy45WAJz~yqGX6K88UhisiwxWg431ROM1J~WX6r8AnboNB099oA5RepAdlmZYBA1HfKoPSbXXvzlDcDBS5YFyD4RrRXJ9rsP52~aVU0Z53ta5si0jiUu807mypmvUEc77jpMbbQY2l2WSC44iLD7MQkPeSSdWnCbgLj9lN0wXUad82ofRAXQJTPGpHV3qcs0iVjQzHB1KC8jLtQF484kZcm4DGZyg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA)
Analysis of CD16A and CD16B genes expressed in donor 17 by PCR.
(A) Restriction map of CD16B (neutrophils) and CD16A (natural killer [NK] cells). Gene-specific restriction endonuclease sites Dra I (D) and Taq I (T) are indicated in a box. Also shown are the positions of the primers used for PCR amplification of the segment of the exon 5 (corresponding to 611-825 bp of cDNA). (thick bars) Coding regions of cDNA. (thin bars) Noncoding regions of cDNA. (B) Restriction endonuclease analysis of PCR products recovered from donor 17 and control. The exon 5 segment was amplified with primers 1 (forward, gtttggcagtgtcaa) and 2 (reverse, gctcttattactcccatggga) using genomic DNA from control (left panel) and D17 (right panel). The PCR product was treated without (lanes 1 and 3) or with Dra I (lanes 2 and 4) or with Taq I (lanes 3 and 6), and then it was analyzed by 2% NuSieve agarose gel.
