Sequence analysis of the 5′ region of intron 2.

(A) Genomic DNA from healthy individuals (n1 and n2) and A47° CGD patients (p1 and p2) was amplified using the primers 2LA, 2LB, 2RA, and 2RB. The PCR product of the pseudogene contained the 20-bp duplication located 176-bp downstream of the 5′ end of intron 2. Patient p1 had only the 20-bp duplication characteristic for the pseudogenes, whereas patient p2 and healthy individuals showed both the single 20-bp sequence of the wild-type gene and the 20-bp duplication, as indicated by 2 overlying sequences in intron 2. (B) Direct sequence analysis of fragments amplified across the 5′ region of intron 2 using the above primers and directly subcloned into pTA (Invitrogen). Sequence analysis used the reverse primer, and the orientation of the nucleotides is T, G, C, and A across the 4 lanes for each reaction. The DNA template for PCR was normal genomic DNA, and individual clones were analyzed in lanes 1, 2, 4, 5, and 6. Lane 3 represents a 1:1 mixing of the clones sequenced in lanes 1 and 4. Lanes 1 and 2 demonstrate the wild-type sequence, which includes only 1 copy of the 20-bp repeat unit CAGGGTCTTGCTCTGTCACC, whereas lanes 4, 5, and 6 show the repeat (indicated by brackets).