Molecular phenotype of the Glanzmann thrombasthenic mice.
(A) RT-PCR analysis of the expression of genes in wild-type (+/+) and αIIb-null mice (−/−). BM RNA was amplified using sense primers (A) and antisense primers (B) as follows. For the αIIb gene, 2 different 5′-oligonucleotides were used with the same 3′-primer: αIIb1 (A): CCTGTTTAGGACGTTTGGGAAG; αIIb2 (A): CACCACTGTTCTTGGGTCCTAG; αIib (B): GGGCGGTAGCTGGAGATGATG; tk (A): CCCCTGCCATCAACACGCG; tk (B): CGATGGGGATGGCGGTCGAAG; β3(A): ACTACACGCACTGACACCTGCATG; β3 (B): ACACTCCACACACTCCTTCTT; HPRT (A): GCTGGTGAAAAGGACCTCT; and HPRT (B): CACAGGACTAGAACACCTGC. The sizes of the amplified products are as follows: HPRT, 250 bp; tk, 411 bp; αIIb1, 777 bp; αIIb2, 677 bp; and β3, 123 bp. (C) Product from a control PCR with RT omitted. (B) Immunoblot analysis of platelet proteins from adult wild type (+/+), heterozygous (+/−), and homozygous (−/−) mice. Platelet pellets (50 × 106) were lysed in Tris buffer, 0.125 mol/L, pH 6.8, containing 2.5% SDS, 25% glycerin, 0.5 mg/mL leupeptin (Boehringer), and 2-mercaptoethanol 0.7 mol/L. The solubilized proteins were heated to 100°C for 5 minutes, electrophoresed on a 7.5% polyacrylamide gel, and transferred to a polyvinylidene fluoride membrane (Boehringer). Then αIIb was detected using the monoclonal antibody D12A raised against human αIIb. Bound primary antibody was developed with a goat antimouse alkaline phosphatase (AP) antibody (Sigma) and enhanced using the CDP-Star chemiluminescence system (Amersham). For the data shown, the film was exposed to the blot for 5 seconds. The only reactive species noted on the blot migrates as predicted for native αIIb protein.
