Down-regulation of in vitro DNA-binding activity of STAT3 by BMP-2.

EMSA using untreated U266 nuclear extracts (lane 1) and a radiolabeled STAT3 wild-type probe (GATCCGACATTTCCCGTAAATCG) generated DNA-protein complexes (arrows, lane 2), which were eliminated by a 100-fold molar excess of self-competitor (lane 5), but not by the same molar excess of the mutant STAT3 oligonucleotide that lacks the STAT binding site (lane 6). A similar sequence-specific DNA-binding activity was seen with the use of nuclear extracts from U266 cells treated with BMP-2 for 120 minutes (lanes 7-8). Supershift assays using the radiolabeled STAT3 probe, untreated or BMP-2–treated nuclear extract, and an anti-STAT3 polyclonal antibody eliminated cells that had been treated with a slowly migrating complex (indicated by the asterisk) (lanes 9-10). The uppermost DNA-protein complexes generated by nuclear extract prepared with BMP-2 for either 30 minutes or 120 minutes (lanes 3 and 4, respectively) were lower in intensity compared with those from untreated nuclear extract. The position of the free probe is indicated at the bottom of the gels.