Fig. 1. The factor X promoter contains a canonical GATA site that binds a GATA factor in the liver. / (A) An oligonucleotide containing the GATA site from the factor X promoter, F.X wt GATA (−109 GCCTAAGCCAAGTGATAAGCAGCCAGACAA −80) was radiolabeled and incubated with 10 μg nuclear extracts from various tissues as indicated. F.X mut GATA contains a point mutation that changes GATA to CATA. An arrow indicates the position of the specific DNA-protein complex. (B) F.X wt GATA probe was incubated with liver extracts in the presence of molar excess of unlabeled competitors as indicated. The faster migrating band under the specific complex in lanes 1 and 5 is not always present and is considered nonspecific.
Fig. 1.

The factor X promoter contains a canonical GATA site that binds a GATA factor in the liver.

(A) An oligonucleotide containing the GATA site from the factor X promoter, F.X wt GATA (−109 GCCTAAGCCAAGTGATAAGCAGCCAGACAA −80) was radiolabeled and incubated with 10 μg nuclear extracts from various tissues as indicated. F.X mut GATA contains a point mutation that changes GATA to CATA. An arrow indicates the position of the specific DNA-protein complex. (B) F.X wt GATA probe was incubated with liver extracts in the presence of molar excess of unlabeled competitors as indicated. The faster migrating band under the specific complex in lanes 1 and 5 is not always present and is considered nonspecific.

or Create an Account

Close Modal
Close Modal