Fig. 1.
Fig. 1. Hemoglobin and DNA analysis of the Senegalese δ0β+thalassamia and the rearranged gene structure of the novel fusion gene. / (A) High-performance liquid chromatography (variant system, Biorad Laboratories, Richmond, CA) profiles of the hemolysates from the proband's father (i), mother (ii), a control sample of Hb Lepore heterozygote (iii), and the proband (iv). In this system, Hb Lepore migrates at the position of HbA2. The level of the proband's HbA was assessed to be 11.7% of total hemoglobin. (B) Isoelectrofocusing profiles of the following hemolysates from a control sample of Hb Lepore heterozygote (1), in vitro mixed HbA/ Hb Lepore and HbA/HbS (2), mother (3), father (4), and a healthy individual (5). Hb Lepore is clearly distinguished from HbS and no Hb Lepore was detected in the father even after overloading. (C) Agarose electrophoretic profile of the PCR products. PCR products obtained by using primers8 E1, 5′GACACACATGACAGAA CAGCCAAT3′; GenBank coordinates: 54586-54610; E25′CGATCTTCAATATGCTTACCAAG3′; coordinates: 61848-61870; and E3 5′CATTCGTCTCTTTCCCATTCTA3′, coordinates: 62763-62742 are in lanes 1 to 3 and those with E1 and E3, in lanes 4 and 5. In this system, the E2-E3 pair generates a 915-bp fragment for a normal β-globin gene and the E1-E3 pair, a 777-bp fragment for Lepore-type chromosome, whereas E1-E3 are too far to produce a PCR fragment under our experimental conditions. The template DNA used is from the proband's mother (lane 1), the father (lanes 2 and 4), and an individual heterozygous for Hb Lepore (lanes 3 and 5). (D) Schematic representation of the normal human δ- and β-globin gene arrangement, the Lepore Boston-Washington gene, and the herein described δβ fusion gene. The boxes, ▨ and ░, respectively represent the δ-globin gene promoter and exons and, ▤ and ▪, respectively represent the β-globin gene promoter and exons. The position and orientation of the E1, E2, and E3 primers are also indicated. A indicates HbA; F, HbF; A2, HbA2; S, HbS; L, Hb Lepore; B, PCR blanks; M, molecular size marker.

Hemoglobin and DNA analysis of the Senegalese δ0β+thalassamia and the rearranged gene structure of the novel fusion gene.

(A) High-performance liquid chromatography (variant system, Biorad Laboratories, Richmond, CA) profiles of the hemolysates from the proband's father (i), mother (ii), a control sample of Hb Lepore heterozygote (iii), and the proband (iv). In this system, Hb Lepore migrates at the position of HbA2. The level of the proband's HbA was assessed to be 11.7% of total hemoglobin. (B) Isoelectrofocusing profiles of the following hemolysates from a control sample of Hb Lepore heterozygote (1), in vitro mixed HbA/ Hb Lepore and HbA/HbS (2), mother (3), father (4), and a healthy individual (5). Hb Lepore is clearly distinguished from HbS and no Hb Lepore was detected in the father even after overloading. (C) Agarose electrophoretic profile of the PCR products. PCR products obtained by using primers8 E1, 5′GACACACATGACAGAA CAGCCAAT3′; GenBank coordinates: 54586-54610; E25′CGATCTTCAATATGCTTACCAAG3′; coordinates: 61848-61870; and E3 5′CATTCGTCTCTTTCCCATTCTA3′, coordinates: 62763-62742 are in lanes 1 to 3 and those with E1 and E3, in lanes 4 and 5. In this system, the E2-E3 pair generates a 915-bp fragment for a normal β-globin gene and the E1-E3 pair, a 777-bp fragment for Lepore-type chromosome, whereas E1-E3 are too far to produce a PCR fragment under our experimental conditions. The template DNA used is from the proband's mother (lane 1), the father (lanes 2 and 4), and an individual heterozygous for Hb Lepore (lanes 3 and 5). (D) Schematic representation of the normal human δ- and β-globin gene arrangement, the Lepore Boston-Washington gene, and the herein described δβ fusion gene. The boxes, ▨ and ░, respectively represent the δ-globin gene promoter and exons and, ▤ and ▪, respectively represent the β-globin gene promoter and exons. The position and orientation of the E1, E2, and E3 primers are also indicated. A indicates HbA; F, HbF; A2, HbA2; S, HbS; L, Hb Lepore; B, PCR blanks; M, molecular size marker.

Close Modal
This Feature Is Available To Subscribers Only

or Create an Account

Close Modal
Close Modal