Binding of nuclear proteins from 293 cells to the FR-β promoter sequence – 338 nt to – 308 nt containing the repressor element. Nuclear extract from 293 cells and 32P-labeled probe (– 338 nt to – 308 nt) were used in the EMSA as described in “Materials and methods.” (A) Competition assay to map the protein binding site for the major and specific EMSA band (arrow) observed for the wild-type probe, – 338 nt to – 308 nt. Lanes 1 to 12, 30 000 cpm 32P-labeled probe; lane 2, 2.5 μg 293 cell nuclear extract; lanes 3 to 12, 5 μg 293 nuclear extract; lane 4, 50-fold excess wild-type unlabeled probe (– 338 nt to – 308 nt); lane 5, 100-fold excess wild-type unlabeled probe (– 338 nt to – 308 nt); and lanes 6 to 12, 100-fold unlabeled mutated probes, each with 2 consecutive nucleotides mutated from pyrimidine to purine or vice versa. The positions of the mutated nucleotides are indicated as follows in parentheses: lane 6, m(– 322 nt, – 321 nt); lane 7, m(– 320 nt, – 319 nt); lane 8, m(– 318 nt, – 317 nt); lane 9, m(– 316 nt, – 315 nt); lane 10, m(– 330 nt, – 329 nt); lane 11, m(– 328 nt, – 327 nt); and lane 12, m(– 325 nt, – 324 nt). (B) Effect of unlabeled consensus AP-1 probe and broadly reactive anti–AP-1 antibodies (anti–pan-Jun and anti–pan-Fos) on specific nuclear protein binding (arrow) to the labeled probe – 338 nt to – 308 nt. Lanes 1 to 8, 30 000 cpm 32P-labeled probe; lanes 2 to 8, 5 μg 293 cell nuclear extract; lane 3, 50-fold excess wild-type unlabeled probe; lane 4, 100-fold excess wild-type unlabeled probe; lane 5, 100-fold unlabeled 21-mer AP-1 consensus probe (sequence, CGCTTGATGACTCAGCCGGGAA); lane 6, 2.5 μg anti–pan-Jun antibody (broadly reactive with c-Jun, Jun B, and Jun D); lane 7, 2.5 μg anti–pan-Fos antibody (broadly reactive with c-Fos, FosB, Fra-1, and Fra-2); and lane 8, 2.5 μg normal rabbit IgG. (C) Effect of antibodies to specific Fos-family transcription factors on specific nuclear protein binding (arrow) to the labeled probe – 338 nt to – 308 nt. Lanes 1 to 7, 30 000 cpm 32P-labeled probes; lanes 2 to 7, 5 μg 293 nuclear extract; lane 3, 2.5 μg anti–c-Fos antibody; lane 4, 2.5 μg anti-FosB antibody; lane 5, 2.5 μg anti–Fra-1 antibody; lane 6, 2.5 μg anti–Fra-2 antibody; and lane 7, 2.5 μg normal rabbit IgG.