Binding of nuclear proteins from 293 cells to FR-β promoter sequence – 368 nt to – 328 nt containing the repressor element. Nuclear extracts from 293 cells were used in EMSA as described in “Materials and methods.” (A) Competition assay to map the 293 nuclear protein binding site for and specific EMSA band (arrows) observed for the wild-type probe, – 368 nt to – 328 nt. Lanes 1 to 7, 30 000 cpm ³²P-labeled probe; lanes 2 to 7, 5 μg 293 nuclear extract; lane 3, 50-fold excess wild-type unlabeled probe (– 368 nt to – 328 nt); lane 4, 100-fold excess wild-type unlabeled probe (– 368 nt to – 328 nt); and lanes 5 to 7, 100-fold unlabeled mutated probes, each with 2 consecutive nucleotides mutated from pyrimidine to purine or vice versa. The positions of the mutated nucleotides are indicated as follows in parentheses: lane 5, m(– 360 nt, – 359 nt); lane 6; m(– 355 nt, – 354 nt); and lane 7, m(– 350 nt, – 349 nt). (B) Effect of unlabeled consensus AP-1 probe and anti–AP-1 antibodies on specific 293 nuclear protein binding (arrows) to the FR-β promoter – 368 nt to – 328 nt. Lanes 1 to 11, 30 000 cpm ³²P-labeled probe; lanes 2 to 11, 5 μg 293 cell nuclear extract; lane 3, 50-fold excess wild-type unlabeled probe; lane 4, 100-fold excess wild-type unlabeled probe; lane 5, 100-fold unlabeled 21-mer AP-1 consensus probe (sequence, CGCTTGATGACTCAGCCGGGAA); lane 6, 2.5 μg anti–pan-Jun (broadly reactive) antibody; lane 7, 2.5 μg anti–pan-Fos (broadly reactive) antibody; lane 8, 2.5 μg anti–c-Fos antibody; lane 9, 2.5 μg anti-FosB antibody; lane 10, 2.5 μg anti–Fra-1 antibody; and lane 11, 2.5 μg anti–Fra-2 antibody.