MYH11 overexpression in CBFB-MYH11– positive cells. The expression in CBFB-MYH11–positive ME-1 cells was set at 1.0. From all cases informed consent was obtained in accordance with the Declaration of Helsinki. The numbers indicate the following: (1) newly diagnosed CBFB-MYH11–positive AML (n = 11); (2) newly diagnosed CBFB-MYH11–negative AML (n = 21); (3) CBFB-MYH11–positive cases in complete hematologic remission (n = 2); (4) de novo chronic myeloid leukemia (n = 9); (5) history of chronic myeloid leukemia (n = 10); (6) de novo acute lymphocytic leukemia (n = 3); and (7) healthy volunteers (n = 2). ○ and • indicate blood and bone marrow samples, respectively. Primers and probes were developed downstream of all known MYH11 fusion points using Primer Express version 1.5 (Applied Biosystems, Foster City, CA). Sequences (5′-3′) of MYH11 forward and reverse primers and probe are respectively, AGTAGCCTGTCGGGAAGGAAC, GCCTGCTGTGTGGCTTTG, CACTCCAGGACGAGAAGCGCCG. The cDNA synthesis and input, cycling conditions, and PBGD expression measured for normalization were as described.⁹  For quantification, serial log dilutions of cDNA in H₂O derived from the CBFB-MYH11–positive cell line ME-1 were used. Linear amplification extended down to a 4 log dilution.