Generation and characterization of EC-specificS1P₁knock-out mice. (A) Targeting strategy to introduce the loxP sites into S1P₁ gene. The S1P₁ gene consists of 2 exons and 1 intron; the second exon (E2) contains the entire coding region. A 5.2-kilobase (kb) BamHI-SacI fragment, including exons 1 and 2 of the S1P₁ gene, was subcloned into the XhoI site of the pLoxpneo vector¹⁹  upstream of the neo cassette to place one loxP site (▵) within the intron. A 3.8-kb SacI-BamHI fragment containing the 3′ untranslated region was subcloned downstream of the neo cassette which has associated 2 other loxP sites. ^*BglII restriction site was inactivated during construction of the targeting vector. (B) The loxed S1P₁ gene (top; S1P₁^loxP) and the structure of the gene after Cre-mediated recombination (bottom; S1P₁^ΔEx2). For detecting the wild-type (S1P₁^WT), knock-out (S1P₁^Ko), and conditional alleles (S1P₁^loxP) by polymerase chain reaction (PCR), the following primers were used: P1, 5′GAGCGGAGGAAGTTAAAAGTG; P2, 5′CCTCCTAAGAGATTGCAGCAA. P1 and P2 amplify an approximately 250-bp fragment for the S1P₁^loxP allele and a 200-bp fragment for the S1P₁^WT and S1P₁^Ko alleles. To detect the S1P₁^ΔEx2 allele, P1 and P3 (5′GATCCTAAGGCAATGTCCTAGAATGGGACA) were used. P1 and P3 amplify a 200-bp fragment. When primers P1, P2, and P3 were used in the same PCR reaction, the PCR products were digested with SacI prior to the electrophoresis, which converted the S1P₁^ΔEx2 fragment to 180 bp.