Expression of mGATA-1 in the human DS-AMKL cell line, MGS. (A) Immunoblotting analyses of GATA-1. Full-length mGATA-1 and the short form of mGATA-1 (ΔNT) were retrovirally introduced into MGS cells. Nuclear extracts were transferred onto polyvinylidene difluoride membranes and processed for reaction with the N6 monoclonal antibody, which recognizes the N-terminus of GATA-1 (upper panel), and M-20 polyclonal antibody, which recognizes the C-terminus of GATA-1 (middle panel), and rat anti–mGATA-1 antiserum (lower panel). (B) Semiquantitative RT-PCR analysis of GATA-1 transcripts from MGS cells expressing full-length mGATA-1 (GATA-1) and the short form of mGATA-1 (ΔNT). PCR reactions were performed for the indicated number of cycles using a set of primers (5′ CTACCCTGCCTCAACTGTGT 3′ and 5′ AAGCCACCAGCTGGTCCTTC 3′) corresponding to the sequences with 100% homology between mouse and human GATA-1. PCR products before digestion (upper panel) and after digestion (lower panel) with HindIII were electrophoresed in 2.5% agarose gels.