Location of the amplification and sequencing primers on the EPCR gene. Exons are symbolized by boxes. The 5′ part of exon 1 and the 3′ part of exon 4, which are noncoding, are striped. The primer pairs used to amplify nearly the entire gene in 7 PCR runs are indicated, and the size of the amplification products (in base pairs) is indicated between brackets. The oligonucleotides are numbered according to the position of their 5′ nucleotide on sequence AF 106202 (Genbank accession number), followed by Fr for sense primers or Rv for antisense primers. The sequences of the amplification primers are indicated, from 5′ to 3′: PCR1: 61Fr GCTGAAGTGGGCGGATCACC and 1137Rv TCTAGCCTGGGTCATGCGGC; PCR2: 1114Fr TCTTGCCGCATGACCCAGGC and 2212Rv GGAAGGAGGCCAGGAGATGG; PCR3: 1511Fr CTCTTACTAAGGGTGACGCG and 3540Rv TCTGATGCCCCACGAGACAC; PCR4: 2528Fr TCTCTACAGGGCAGGCAGAG and 5012Rv TCGTGGTGTTGGTGTCTGGG; PCR5: 4640Fr AGGAGTGTCTCTTCCACTGC and 5540Rv CTTGTATGAGAAGTGGCTGG; PCR6: 4993Fr CCCAGACACCAACACCACGAT and 7320Rv GTCTGTCTTTGGAGGATGGG; and PCR7: 7171Fr AGAGGTGGACAAAGTACTTGG and 8158Rv GGAAGCCAGCATTTCCAGGG. The positions of the primers used to sequence the amplified regions are shown schematically; the full sequences are available on request.