Expression of Fugu Epo in PLHC-1 and HepG2 cell lines. An 11-kb genomic fragment of the Fugu Epo was transfected into the PLHC-1 (A) or HepG2 (B) cell lines that were cultured under normal (Control), hypoxic, or anaerobic conditions, or in the presence of cobalt chloride (CoCl2). HepG2 cells did not survive under anaerobic conditions. The expression of Fugu Epo (fEpo) was analyzed by RT-PCR. PCR was also done with an aliquot of the RNA treated with DNAse that was used to synthesize cDNA (fEpo(-RT)) to check for residual genomic DNA in the cDNA preparations. The larger fEpo band (290 bp) represents unspliced transcript and the smaller band (193 bp) the spliced transcript. Endogenous actin or human glyceraldehyde-3-phosphate dehydrogenase (hG3PDH) fragment was amplified as an internal control. Both were found to be efficiently spliced. The following primers were used to amplify hG3PDH: 5′ACCACAGTCCATGCCATCAC3′ and 5′TCCACCACCCTGTTGCTGTA3′.
