16189 Mitocondrial Variant and Iron Overload.

Hereditary haemochromatosis(HH) is one of the most common autosomal recessive diseases in Europe, this is characterized by iron overload. There are two predominant mutations associated with the disease in the HFE gene: C282Y and H63D. The majority of haemochromatosis patients are homozygous for C282Y mutation and a small proportion are compound heterozygous C282Y/H63D. Not all C282Y homozygotes and compound heterozygous will show signs of iron loading. Several studies have shown the incomplete penetrance of haemochromatosis and suggest that iron overload is influenced by both enviromental and genetic factors wich may modify the phenotipic expression of the disease.

Iron loading is associated with impaired mitochondrial function. It has been reported that the T16189C variant of mitochondrial DNA may act as a modifier increasing iron loading in HH. 16189 variant lies in the first hypervariable region (HV1), close to the sequences controlling replication and transcription.

Aim: to determine the frequency of the 16189 variant in normal population and in a group of HH pacients with mutations in HFE gene or iron loading due to Mayor or Intermediate b-Thalassemia.

Materials and methods: We stablished the frequence of 16189 variant in normal population by studying it in a group of 102 blood donors which did not have any mutation in HFE gene. We determined the variant in 27 C282Y homozygous, 32 compound heterozygous C282Y/H63D and 31 H63D homozygous and 16 β-thalassemics aswell.

DNA was extracted from peripheral blood, HV1 region was amplified by PCR using primers:

F(15800–15819)CAAGTAGCATCCGT ACTATA; R(16344–16325)GTAATGTGCTATGTACGGTA The product of amlification was digested with MnlI acording to manufacturer’s specifications. In wild type there is a restriction site at position 16189 which is absent in mutant allele. All samples lacking MnlI site were directly sequenced in a ABI PRISM 310 Genetic Analyzer.

Statistical analysis was performed using the SPSS package.

Results: shown in table 1

Conclusions: Our results do not show significant differences between the groups analyzed, but no significant increased frequency of the variant in the group of compound heterozygous. With this study we cannot conclude that mitochondrial function influences iron overload. This is could be dued to the short number of samples analyzed. In β-Thalassemia iron loading is modifed by an increased absorption(TM y TI) and transfusions(TM). At the present we are studying other factors that could play an important role in iron homeostasis: Transferrin receptor, Hepcidine and Hemojuveline.