Over-expression of the MN1 gene has been reported in AML, and appears to be associated with the inv(16) subgroup. In a study of 142 patients with normal karyotype (NK) it was found to be an adverse prognostic factor for CR and overall survival in older patients (

Heuser et al Blood 2006, 108:3898
). In addition over-expression correlates with unmutated NPM1 and resistance to ATRA in combination with chemotherapy in non-APL with NK (
Heuser et al Blood 2007, 110:1639
). The UK MRC 12 trial treated patients with standard induction of ADE/MAE/DAT followed by 2 or 3 consolidation courses (MACE/MidAc/ICE). Of the 3459 patients recruited to the trial 1097 were also randomised to receive ATRA 45mg/m2/d (d 1–60); all these patients received DAT chemotherapy. Diagnostic samples were available from 196 patients in the ATRA randomisation for a retrospective analysis of the prognostic impact of MN1 over-expression.

Methods: cDNA was generated using random priming and MuLV reverse transcriptase (Applied Biosystems). MN1 exon 1 forward, ATTGACCTGGACTCGCTGATG (

Carella et al. Leukemia, 2007, 21:1679
) and MN1 exon2 reverse, TGCTGAGGCCTTGTTTGCA primers were used to measure RNA abundance, giving a product of 174bp. The expression of ABL was used as an endogenous control: primers NA4_abl_exon4 CGGCTCTCGGAGGAGACGTAGA and A2N_abl-exon2 CCCAACCTTTTCGTTGCACTGT (
Emig et al, Leukemia 1999, 13:1825
) resulting in a product of 386 bp. Both primer sets are intron spanning and do not function on genomic DNA. PCR reactions were carried out to ensure linear amplification using dilutions of an inv(16) patient sample across the expected range which enabled the relative concentrations of MN1 and ABL, and the expression relative to the standard sample, to be calculated.

Results: The median age of patients was 46 years (range 17–68); median follow up was 7.1 years. 107/196 patients were randomised to receive ATRA. MN1 status, whether viewed as high/low, or as a continuous variable was not significantly associated with age, white blood count (WBC) or sex; patients with normal karyotype were found to have lower MN1 levels (p<0.0001), patients with inv(16) or adverse cytogenetics tended to have higher MN1 levels (p=0.001, p=0.0007). Patients with NPM1 mutations, or FLT3-ITD mutations tended to have lower MN1 levels (p<0.0001, p=0.02 respectively). There was no significant impact of MN1 levels on remission rates, overall survival (OS) or relapse in either univariate analyses or those adjusted for age, WBC, sex, cytogenetics, performance status, de Novo/Secondary disease, FLT3-ITD and NPM1 status (effect sizes per log increase in MN1: CR adjusted OR 0.80 (0.42–1.52) p=0.5; OS adjusted HR 0.92 (0.69–1.23) p=0.6; Relapse adjusted HR 1.20 (0.83–1.72) p=0.3). Results were similar if analyses were restricted to normal karyotype patients. Overall there was no significant effect of ATRA, as reported previously (Burnett et al ASH 2002 abstract 529). There was no significant interaction between MN1 level and ATRA treatment for CR (unadjusted p=0.7; adjusted p=0.8) or overall survival (unadjusted p=0.9; adjusted p=0.8). However, in adjusted analyses there was a suggestion that the effect of ATRA on relapse was greater in patients with low MN1 levels (adjusted p=0.08). Similarly, looking at the normal karyotype group only there was no evidence of interaction on CR (adjusted p=0.4) or OS (adjusted p=0.9), with a similar greater effect of ATRA on relapse in low MN1 level patients (adjusted p=0.02).

Conclusions: The data show a possible interaction between MN1 and ATRA treatment on relapse when adjusted for other baseline variables, but no evidence of prognostic value, nor that any effect of ATRA is moderated by MN1 when considering remission or survival.

Topics:
chemotherapy regimen, mn1 gene, tretinoin, karyotype determination procedure, disease remission, impedance threshold device, leukemia, ms-like tyrosine kinase 3, dna, dna, complementary

Disclosures: No relevant conflicts of interest to declare.

Author notes

Corresponding author

2008, The American Society of Hematology
2008
Sign in via your Institution