Identification of a Functional Interferon-Gamma Response Element in the Fibrinogen FGG Gene.

Abstract 3174

Poster Board III-114

Fibrinogen is the zymogen precursor to the main structural protein in blood coagulation, and is proteolytically activated during coagulation to form fibrin clots. Fibrinogen is an acute phase protein that is produced by the liver, and elevated fibrinogen levels are a known risk factor for cardiovascular disease, including heart attack and stroke. Fibrinogen is synthesized from three separate genes, FGA, FGB, and FGG encoding the Aαa, Bβ, and γ chains, respectively. Several inflammatory cytokines, particularly interleukin-6 (IL-6), are known to up-regulate fibrinogen synthesis, while interleukin-1β, tumor necrosis factor-αa, and transforming growth factor-β are known to antagonize IL-6 stimulation of fibrinogen synthesis. Here we report that interferon-γ (IFN-γ), a cytokine that is highly expressed in atherosclerotic lesions, decreases the production of fibrinogen by two-fold over a 24 hour period in HepG2 hepatocellular carcinoma cells, both at the protein and mRNA level. In addition, IFN-γ antagonizes IL-6 up-regulation of fibrinogen production. Since IFN-γ is known to signal via the IFN-γ receptor through a STAT1-dependent pathway, we investigated the mechanism by which IFN-γ inhibits fibrinogen production. We identify a previously unknown IFN-γ activation sequence (GAS), AGGAGCTTACATAAAGGGACAA, within the promoter of the human γ chain gene FGG. This sequence is homologous to the known GAS consensus sequence TTNCNNNAA. Nuclear extracts from IFN-γ-stimulated HepG2 cells, but not from unstimulated HepG2 cells, form a complex with oligonucleotides containing this GAS sequence, as demonstrated by electrophoretic mobility shift assays. The formation of this complex is blocked by unlabeled competing oligonucleotides and by an antibody to phosphorylated STAT1. The involvement of pSTAT1 in this complex is consistent with the known role of pSTAT1 downstream of IFN-γ receptor signaling. In addition, IFN-γ stimulates STAT1 phosphorylation in a dose-dependent manner in HepG2 cells. Furthermore, using an FGG promoter construct fused to a luciferase reporter gene in transiently transfected HepG2 cells, we show that IFN-γ inhibits luciferase expression in a dose-dependent manner. Together, these data demonstrate that IFN-γ down-regulation of fibrinogen production occurs through a pSTAT1-mediated pathway. Since IFN-γ is known to demonstrate both pro and anti-atherogenic actions, this down-regulation of fibrinogen production may serve an anti-atherogenic function in vivo.