miR-155 regulates HGAL expression and increases lymphoma cell motility

HGAL (Human Germinal-center Associated Lymphoma) is a germinal center (GC) specific gene involved in negative regulation of lymphocyte and lymphoma cell motility by at least 2 distinct molecular mechanisms. HGAL directly and independently binds to both actin and myosin II proteins, increasing binding between F-actin and myosin II and inhibiting the ability of myosin to translocate actin by reducing the maximal velocity of myosin head/actin movement.^1,2  In addition, HGAL inhibits lymphocyte motility by activating the RhoA signaling pathway by direct interaction with RhoA-specific guanine nucleotide exchange factors (RhoGEFs) PDZ-RhoGEF and LARG that stimulate the RhoA GDP-GTP exchange rate.³  HGAL is also expressed in GC-derived lymphomas and distinguishes biologically distinct subgroups of diffuse large B-cell lymphomas (DLBCLs)^4,5  and classic Hodgkin lymphoma^6,7  characterized by longer survival. However, little is known about expression regulation of HGAL or its murine counterpart M17 protein. We have previously shown that IL-4 and IL-13 stimulation increases, whereas CD40 stimulation decreases, HGAL mRNA expression.⁴  Recently, we also demonstrated that HGAL is directly regulated by the transcriptional repressor PRDM1/Blimp-1, a master regulator of terminal B-cell differentiation. We showed that PRDM1 directly binds to the recognition sites within the upstream promoter of HGAL and transcriptionally suppresses its endogenous mRNA and protein levels.⁸  However, additional factors most probably contribute to the restricted and tightly regulated expression of HGAL in GC lymphocytes and GC-derived lymphomas.

microRNAs (miRNAs) are small noncoding RNAs that post-transcriptionally regulate expression of genes controlling multiple biologic processes.⁹  The stage-specific expression of certain miRNAs in the immune system¹⁰  suggests their participation in immune system regulation that may contribute to pathogenesis of lymphocyte-derived malignancies.^11,12  Therefore, we have searched for miRNAs implicated in immune responses and lymphomagenesis that might regulate HGAL expression. Herein we demonstrate that miR-155 directly down-regulates HGAL expression by binding to its 3′-untranslated region (3′-UTR), modulating its effects on RhoA activation and lymphocyte and lymphoma cell spontaneous and chemoattractant-induced motility. These findings disclose novel roles of miR-155 in the immune system and lymphoma biology.

Mouse monoclonal anti–HGAL antibody was generated in our laboratory, as reported previously.^13,14  Mouse monoclonal anti–RhoA (26C4) and rabbit polyclonal anti–Rhotekin 2 (RTKN2; AA-18) antibodies were from Santa Cruz Biotechnology; rabbit polyclonal anti–myosin light chain kinase antibody (ab55475) was purchased from Abcam; β-actin antibody (A5316) and sodium lysophosphatidic acid (L7260) were purchased from Sigma-Aldrich; rhodamine labeled phalloidin was from Invitrogen; human fibronectin was purchased from BD Biosciences; SDF-1α was from MBL International.

Three miRNA target prediction algorithms, PicTar (http://pictar.mdc-berlin.de; New York University and Max Delbruck Centrum), miRanda (http://cbio.mskcc.org/mirnaviewer; Memorial Sloan-Kettering Cancer Center), and TargetScan (http://www.targetscan.org; Whitehead Institute for Biomedical Research), were used to identify miRNAs potentially implicated in HGAL regulation. Subsequently, the same programs were used to identify possible miR-155 target genes. The PITA algorithm (http://genie.weizmann.ac.il/pubs/mir07/mir07_prediction.html; Segal Lab of Computational Biology) was used to predict putative miR-155 binding sites.^10,15 

MC116, Raji, SUDHL6, and VAL lymphoma cell lines were cultured in RPMI 1640 medium (Fisher Scientific), supplemented with 10% FBS (Hyclone), 2mM glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin (Invitrogen) at 37°C and 5% CO₂. Human cervical cancer cell line HeLa was grown in DMEM (Invitrogen), supplemented with 10% FBS, 2mM glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin. For fibronectin stimulation, plates (Corning) were precoated overnight at 4°C with a 50-μg/mL solution of fibronectin in PBS (Ca²⁺, Mg²⁺-free, 1 mL/35-mm dish). For LPA treatment, VAL, SUDHL6, or Raji cells, grown in serum-free culture medium for 8 hours, were treated with LPA (1 μg/mL) for 45 seconds.

MC116, Raji, SUDHL6, and VAL DLBCL cell lines were transfected with hsa-miR-155 AM17100 (Ambion) or with pre-miR–negative control (Ambion) by Nucleofector II (Amaxa Biosystems) following the manufacturer's instructions. Cells were collected at 24, 48, and 72 hours after transfection, and levels of indicated proteins were measured by Western blot using specific antibodies, as reported previously.¹⁶ 

The bic/miR-155^−/− mice were kindly provided by Dr Klaus Rajewsky.¹⁷  For control, we used 4 C57BL/6J mice (The Jackson Laboratory). After mice death according to University of Miami institutionally approved protocol, spleens were removed for splenocyte isolation. B cells were enriched by mouse B-cell enrichment kit (StemCell Technologies) and were used for chemotaxis assays, as described in “Chemotaxis assays.” Transfection of mice purified B cells was performed as previously reported.³ 

Total RNA was extracted using the miRNeasy (QIAGEN) isolation kit. For measurement of HGAL mRNA expression, RNA (2 μg) was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocol with a minor modification: addition of RNase inhibitor (Applied Biosystems) at a final concentration of 1 U/μL. The complete reaction mixes were incubated at 25°C for 10 minutes and 37°C for 120 minutes. For miRNA expression analysis, 5 μL of RNA at 2 ng/μL was mixed with 10 μL of TaqMan MicroRNA Reverse Transcription Kit reagent containing specific miRNA primers and reverse-transcribed according to the manufacturer's instructions (Applied Biosystems). Complete reaction mixes were incubated at 16°C for 30 minutes, 42°C for 30 minutes, and 85°C for 5 minutes.

Real-time PCR was performed using the ABI PRISM 7900HT Sequence Detection System Instrument (Applied Biosystems) using commercially available Assay-on-Demand HGAL (HS00277164) and miR-155 TaqMan MicroRNA Assay (ID 002623). Expression of miRNAs was normalized to the expression of endogenous RNU6B, whereas HGAL expression was normalized to 18S (Human TaqMan Pre-Developed Assay Reagent; Applied Biosystems) that served as internal controls of RNA amount and integrity, as previously reported.^10,18  Each measurement was performed in triplicate. Threshold cycle (C_t), the fractional cycle number at which the amount of amplified target reached a fixed threshold, was determined and expression was measured using the 2^−ΔCt formula, as previously reported.¹⁸ 

The 3′-UTR of HGAL and RTKN2 was amplified from the VAL cell line using the Phusion High-Fidelity PCR Master Mix (Finnzymes Oy) according to the manufacturer's instructions. Primers used for amplification of HGAL 3′-UTR were as follows: forward, gggaaatctagatgaagtggctggactagcatttg; and reverse, gggaaatctagatttgggacattaaaatttatttactgg; for RTKN2 3′-UTR: forward, gatctagagtaccaggcagtgaataagccc; and reverse, gatctagagccttctttgcccttgcaag. PCR products were digested with XbaI (New England Biolabs) and ligated into the pGL3-control vector (Promega) linearized with XbaI and dephosphorylated with Shrimp Alkaline Phosphatase (USB). Ligation products were grown in Top10 F′ Escherichia coli (Invitrogen), and individual clones were picked up and confirmed by sequencing.

Mutagenesis of the 3′-UTR luciferase constructs was performed using the QuickChange XL Site-Directed Mutagenesis Kit (Stratagene). The 3′- UTR putative binding sites for miR-155 in the HGAL and RTKN2 were located by using the PITA algorithm.¹⁵  We selected sequences with the highest affinity by comparing ddG values. The seeds (exact location and affinities are detailed in supplemental Figures 1 and 2, available on the Blood Web site; see the Supplemental Materials link at the top of the online article) were mutated using a previously described strategy based on PCR.¹⁹  Primers for mutagenesis of the first HGAL seed (M1) were atagtaagttatatttgtttgaaccttatcctgtgaatcgtaattctgtcccaaacagtatatgccttttatcagggac and gtccctgataaaaggcatatactgtttgggacagaattacgattcacaggataaggttcaaacaaatataacttactat. Primers for mutagenesis of the second HGAL seed (M2) were ccaggatcagatcctcaaaaggaaatattcagaatcgtgtggatattgtacaagatgtaacatggcttag and ctaagccatgttacatcttgtacaatatccacacgattctgaatatttccttttgaggatctgatcctgg.

Primers for mutagenesis of the first RTKN2 seed (M1) were ccaggcagtgaataagccctaggcagaataatcgtaataaatttcttttggggagagactgtcagtaa and ttactagacagtctctccccaaaagaaatttattacgattattctgcctagggcttattcactgcctgg. Primers for mutagenesis of the second RTKN2 seed (M2) were tacctttacatttcaagctctgggatataaattactagtctcgtaatagatagtattatttttaattgctactaagtggtaaacttttg and caaaagttaccacttagtagcaattaaaaataatactatctattacgagactacgtaatttatatcccagagctt gaaatgtaaaggta.

HeLa cells were cotransfected with the constitutively active Renilla reniformis luciferase-producing vector pRL (Promega), hsa-miR-155 or nontargeting pre-miR–negative control 1 (Ambion) and luciferase wild-type or mutated 3′-UTR vectors for HGAL (or RTKN2) using the Siport Neo FX transfection reagent (Ambion), according to the manufacturer's instructions. At 20 hours after transfection, the cells were lysed and Firefly (Photinus pyralis) and Renilla reniformis luciferase activities were measured using the Dual Luciferase assay kit according to the manufacturer's instructions (Promega). Measurements were performed on a Sirius luminometer (Berthold). All the measurements were normalized to the nontargeting pre-miR–negative control 1, which was given a value of 100%. Each experiment was repeated at least 3 times in triplicates (N = 9). Data are presented as mean ± SEM.

F-actin assay in lymphoma cell was performed as described by Vicente-Manzanares et al.²⁰  Briefly, VAL, Raji, and SUDHL 6 cells were completely deprived of serum by extensive washing with PBS and starvation in serum-free culture medium for 8 hours. The cells, resuspended at 1.5 × 10⁶ cells/0.3 mL of serum-free RPMI 1640 medium per tube, were treated with LPA (1.5 μg/mL) for 45 seconds followed by addition of 0.3 mL freshly prepared 2 × fixation-permeabilization staining buffer (8% paraformaldehyde, 2% BSA, 0.4% Triton X-100, 0.6 unit/mL Alexa-488 phalloidin) or 2 × fixation-permeabilization (FP) buffer (8% paraformaldehyde, 2% BSA, 0.4% Triton X-100), incubation at 4°C for 20 minutes, and were analyzed by flow cytometry on a Becton Dickinson BD-LSR I Analytic Flow Cytometer (BD Biosciences).

Chemotaxis assays were performed in 24-well plates (Nalge Nunc International) containing 5.0-μm porous polycarbonate membranes inserts (Corning), as was previously reported.^1,3  Briefly, the inserts were coated with 0.3 mL of 10 μg/mL fibronectin for 1 hour, washed once with 0.3 mL of PBS, and equilibrated with RPMI 1640 medium. Raji, VAL, MC116, or mice splenocytes were washed twice with nonsupplemented RPMI 1640 and resuspended at 5 × 10⁶ cells/mL in serum-free RPMI 1640 medium. IL-6 at 10 ng/mL or SDF-1 at 200 ng/mL in a total volume of 600 μL nonsupplemented RPMI 1640 medium or medium alone were added to the bottom of the wells, and 100 μL of cells was loaded on the inserts. The cells were allowed to migrate for 4 hours at 37°C and 5% CO₂. The number of cells that migrated to the bottom portion of the well was assayed by flow cytometry. All the assays were performed in triplicate.

RhoA activation was measured by pull-down assay (Cytoskeleton) according to the manufacturer's protocol, as reported previously.³  RhoA expression was determined by a Western blot using a RhoA specific antibody.

A 2-tailed Student t test was used, and P < .05 was considered statistically significant.

To elucidate HGAL expression regulation, we searched for miRNAs with reported roles in lymphocyte biology and/or lymphomagenesis that can potentially bind to the HGAL 3′-UTR. Based on the TargetScan algorithm, miRNA155 has 2 putative binding sites in the HGAL 3′-UTR with seeds located at positions 2285 to 2291 and 1844 to 1849 bp of the 2614-bp HGAL 3′-UTR sequence (supplemental Figure 1). To test HGAL regulation by miR-155, its precursor (hsa-miR-155) was transfected into Raji, MC116, and VAL cells. Western blotting of whole-cell lysates showed a decrease of native HGAL protein in Raji, MC116, and VAL cells (Figure 1A) transfected with the hsa-miR-155, compared with control miRNA, with maximal decrease in HGAL levels at 48 hours after transfection. hsa-miR-155 transfection also induced decreases in HGAL mRNA levels at 48 hours after transfection in MC116 and VAL cells and at 24 to 72 hours after transfection in Raji cells (Figure 1B-C; supplemental Figure 3); HGAL mRNA decrease in the VAL cells was mild (20%). Transfection efficacy was confirmed by measuring miR-155 expression levels, demonstrating increased expression after transfection at 24 hours in Raji, MC116, and VAL cells (Figure 1B-C; supplemental Figure 3). Overall, these findings suggest that miR-155 regulates HGAL expression mainly at the protein translation level.

The observed effect of miR-155 on HGAL expression may be direct, by binding to its 3′-UTR, or indirect via regulating intermediary proteins. To test for direct effects, we fused the HGAL 3′-UTR sequence containing 2 miR-155 putative binding sites to a luciferase reporter gene. By cotransfecting the hsa-miR-155 with this construct, we demonstrated that miR-155 significantly repressed luciferase activity compared with a nontargeting control (Figure 1D), supporting a direct effect of miR-155 on HGAL transcripts and in accordance with the results obtained for native proteins by Western blot in DLBCL cell lines. To further demonstrate the specificity of this interaction, we generated reporter constructs in which each of the 2 putative miR-155 binding sites was mutated. The specific binding sites chosen for mutagenesis were selected based on analyzing the accessibility of each putative miR-155 binding site with the PITA algorithm¹⁵  and included: position 2285 to 2291 in the cloned HGAL 3′-UTR, ddG equal to −5.77 (M1) and position 1844 to 1849, ddG equal to −3.62 (M2). Cotransfection of the hsa-miR-155 precursor and the luciferase vector with the HGAL 3′-UTR into HeLa cells resulted in reduced luciferase activity to 45% ± 9% compared with a nontargeting control miRNA precursor. Mutagenesis of the M1 did not lead to recovery of the luciferase activity. Mutation of the M2 putative binding site for this miRNA increased luciferase activity to 85% ± 7%, a value similar to control miRNA and statistically significantly different from the wild-type unmutated construct (Figure 1D). Simultaneous mutation of both M1 and M2 sites did not further rescue luciferase activity (not shown). This observation suggests that miR-155 posttranscriptionally regulates HGAL expression mainly by interacting with the M2 binding site in HGAL 3′-UTR.

In our previous studies, we have demonstrated that HGAL decreases lymphocyte and lymphoma cell motility by activating RhoA and its downstream effectors and by interacting with actin and myosin.^1–3  Consequently, we hypothesized that miR-155, by down-regulating HGAL expression, may increase lymphoma cell motility. To this end, we examined the effects of miR-155 on chemotaxis in response to SDF-1 and IL-6 in Raji, VAL, and MC116 lymphoma cells. Compared with control miRNA precursor, hsa-miR-155 transfection markedly increased SDF-1-stimulated lymphoma cell chemotaxis while decreasing expression of HGAL protein (Figure 2A). The same results were observed with IL-6 (not shown). Examining spontaneous motility of Raji cells using time lapse images also demonstrated significant increases in cell migration and cell velocity after hsa-miR-155 transfection compared with cells transfected with control miRNA precursor (Figure 2B-C; supplemental Video 1). By increasing RhoA activity, HGAL also affects RhoA downstream effectors regulating stress fiber formation and actin polymerization.^1,3  Consequently, we have examined the effects of miR-155 on RhoA activation and F-actin polymerization. Transfection of the hsa-miR-155 into Raji, SUDHL6, and VAL lymphoma cells decreased RhoA activity as measured by expression of RhoA-GTP, whereas flow cytometric analysis showed decrease in LPA-induced phalloidin-stained polymerized F-actin compared with cells transfected with control miRNA precursor (Figure 3).

To extend these observations to nonmanipulated, nontransfected cells and normal lymphocytes, we examined chemotaxis of bic/miR-155^−/−17  and control mice splenocytes in response to SDF-1 or IL-6. Splenocytes from the bic/miR-155^−/− mice exhibited significantly decreased chemotaxis to both SDF-1 (P = .03) and IL-6 (P = .002) compared with control mice splenocytes (Figure 4). Overall, these observations demonstrate that miR-155 increases lymphoma and normal lymphocyte motility.

Although the observed effects of miR-155 on human lymphoma and mice splenocyte motility might be mediated by down-regulation of HGAL expression, it is possible that miR-155 also regulates additional proteins in the RhoA signaling pathway. Indeed, previous studies suggested that miR-155 regulates expression of RhoA protein in mouse mammary epithelial cells.²¹  However, transfection of the hsa-miR155 into Raji, SUDHL6, and VAL lymphoma cell lines did not affect total RhoA protein levels (Figure 3A), suggesting that it is not directly targeted by miR-155 in human lymphoma cells. Examination of RhoA and RhoA-GTP levels in unstimulated bic/miR-155^−/− splenocytes also revealed decreased and not increased expression, in contrast to previous in vitro report in mouse mammary epithelial cells²¹  (supplemental Figure 4). Whether this discrepancy represents an indirect consequence of miR-155 knockdown in mouse splenocytes will require additional studies. Examination of the 3′UTR sequence of the M17 transcript, a mouse homolog of human HGAL, revealed that it harbors a miR-155 putative binding site based on TargetScan program, whereas no putative binding sites were detected using the the PicTar and miRanda prediction algorithms (supplemental Figure 5). However, overexpression of miR-155 in mice enriched B lymphocytes did not affect M17 mRNA (data not shown) and protein expression (supplemental Figure 6), and levels of the M17 protein in the bic/miR-155^−/− splenocytes were not increased. These observations suggested that, although miR-155 similarly affects motility of both human B-cell lymphoma and mouse splenocytes, the mechanisms are different between human and mouse cells. Because we were interested in the effect of miR-155 on HGAL and human lymphoma cells, we further focused our studies only on the human cells and did not examine the molecular mechanisms of miR-155 effects on mice splenocyte motility.

Using 3 different prediction algorithms, a search for additional potential miR-155 targets in the RhoA signaling pathway revealed putative miR-155 binding sites in the myosin light chain kinase (MYLK) and Rhotekin 2 (RTKN2). MYLK is a calcium/calmodulin-dependent enzyme that phosphorylates myosin regulatory light chain to facilitate myosin interaction with actin filaments to produce contractile activity.²²  Myosin regulatory light chain is also phosphorylated by RhoA downstream effectors Rho kinase and citron kinase.^23,24  The rhotekin family of proteins inhibits the intrinsic GTPase activity of RhoA proteins, thus interfering with the conversion of active, GTP-bound RhoA to the inactive GDP-bound form.²⁵  hsa-miR-155 transfection into Raji, VAL, and MC116 lymphoma cells led to decreased RTKN2 protein levels but did not affect expression of the MYLK protein (Figure 5A). The levels of the RTKN2 and MYLK proteins were not increased in the bic/miR-155^−/− splenocytes (supplemental Figure 4), further suggesting that miR-155 targets may be different in human lymphoma and mice lymphocytes.

To test for direct effect in human cells, we fused RTKN2 3′-UTR sequence containing 2 miR-155 putative binding sites to a luciferase reporter gene. By cotransfecting the hsa–miR-155 with this construct, we demonstrated that miR-155 significantly repressed luciferase activity compared with a nontargeting control (Figure 5B), supporting a direct effect. To further demonstrate the specificity of this interaction, we generated reporter constructs in which each of the 2 putative miR-155 binding sites was mutated individually or in combination. The following putative binding sites were selected for mutations: M1 positions 1891 to 1899 in the cloned RTKN2 3′-UTR, ddG equal to −4.63; M2 positions 3491 to 3499 ddG equal to −1.77 and M1 + 2 mutant containing both mutations. Cotransfection of the hsa-miR-155 precursor with the luciferase vector harboring RTKN2 3′-UTR into HeLa cells resulted in reduced luciferase activity to 60% ± 2.3% compared with a nontargeting control miRNA precursor. Mutagenesis of the M1 recovered luciferase activity to 75% ± 2.4% compared with a nontargeting control miRNA precursor. Mutation of the second putative site for this miRNA (M2) increased luciferase activity to 80% ± 1%, and the combined mutation of both sites (M1 + 2) completely restored luciferase activity to a nonstatistically different level from the nontargeting control (Figure 5B). These findings suggest that miR-155 may increase human lymphoma cell motility by targeting HGAL, RTKN2, and possibly additional presently unknown gene transcripts.

To determine the relative role of HGAL in mediating miR-155 effects on human lymphoma cell motility, we performed rescue experiments using the pcDNA3.1-HGAL vector, in which the HGAL cDNA is fused to the V5 tag and is lacking the 3′-UTR region harboring the miR-155 binding sites (Figure 6). As expected, hsa-miR-155 transfection led to decreased endogenous HGAL protein expression and a statistically significant increase in SDF-1 chemotaxis. Cotransfection of pcDNA3-HGAL with hsa-miR-155 did not prevent a decrease in endogenous HGAL expression but completely abrogated the increase in SDF-1–induced chemotaxis to levels indistinguishable from control miRNA. Similar data were observed with IL-6–induced chemotaxis (not shown). Overall, these observations suggest that HGAL is one of the major targets mediating the miR-155 effects on human lymphoma cell motility.

miR-155 is a miRNA processed from a primary transcript B-cell integration cluster located on chromosome 21^26,27  encoded by a gene originally isolated near a common retroviral integration site in avian leukosis virus-induced lymphomas.²⁸  Expression of miR-155 is induced in human B lymphocytes after antigen receptor engagement.^17,29  miR-155–deficient mice demonstrate normal immune cell populations in steady-state conditions; however, they exhibit defective B-cell intrinsic humoral responses after immunization that involve impaired GC formation and diminished class switching to immunoglobulin G1.^17,30  Overall, these observations suggest an active miR-155 role in immune response.³¹  Although some of these effects may be attributed to direct down-regulation of PU.1,^30,32  activation-induced cytidine deaminase,^33,34  mothers against decapentaplegic homolog 5,³⁵  Src homology 2 domain-containing inositol-5-phosphatase,^36,37  and CCAAT enhancer-binding protein β expression,³⁷  most of the miR-155 direct targets are unknown. Herein we demonstrate that miR-155 regulates expression of GC-specific protein HGAL as well as RTKN2, both controlling RhoA signaling and normal lymphocyte motility.

HGAL, specifically expressed in GC lymphocytes and GC-derived lymphomas,⁴  is implicated in lymphocyte motility inhibition, potentially restricting GC lymphocytes to GC microenvironment. We have previously reported that, compared with GC lymphocytes, plasma and memory B cells express lower HGAL RNA levels and lack HGAL protein expression,⁴  while expressing higher levels of miR-155¹⁰  and PRDM1, another direct regulator of HGAL expression.⁸  B-cell receptor^29,30  and/or NFκB activation³²  during GC lymphocyte differentiation process can up-regulate miR-155 and PRDM1 expression leading to decreased HGAL protein expression, increasing lymphocyte motility and potentially affecting egress from GC. As shown herein and in our previous work, both miR-155 and PRDM1 directly regulate HGAL expression,⁸  and overexpression of PRDM1 in DLBCL cell lines is not increasing miR-155 expression (data not shown). Overall, our current observations extend our previous findings on HGAL regulation by the PRDM1⁸  and identify a novel role of miR-155 in immune system.

miR-155 is also implicated in pathogenesis of lymphoid malignancies. B-cell restricted expression of miR-155 in mice triggers a polyclonal pro-B cell proliferation and leukemia,³⁸  suggesting its role in B-cell transformation. Kaposi sarcoma-associated herpesvirus, implicated in the pathogenesis of certain B-cell lymphomas, expresses miR-155 orthologs,³⁹  whereas latent B-cell infection with EBV induce expression of endogenous miR-155.⁴⁰  Furthermore, high expression of B-cell integration cluster and miR-155 was reported in Hodgkin lymphoma,^41,42  primary mediastinal B-cell lymphoma, and activated B-cell like (ABC) DLBCL.^{10,41,43–46}  Hodgkin lymphoma cells are characterized by expression of both miR-155 and HGAL,⁶  suggesting presence of additional regulatory factors that may interfere with the observed down-regulation of HGAL by miR-155. Indeed, these tumors are characterized by high expression of IL-4 and IL-13, which are strong stimulators of HGAL expression^4,6  and most probably override the inhibitory effects of miR-155 on the HGAL. ABC-like DLBCLs are characterized by low HGAL protein expression, which we identified as a direct target of this miR-155. miR-155 induced down-regulation of HGAL and RTKN2 expression and decreased RhoA signaling, resulting in increased human lymphoma cell motility. This effect may contribute to the more aggressive behavior and inferior survival of ABC-like DLBCL expressing miR-155.^10,44,47  Indeed, constitutive miR-155 overexpression in a human DLBCL cell line was previously reported to result in larger and more widespread tumors in a xenograft mouse model.³⁸  Although initially attributed to the effect of miR-155 on mothers against decapentaplegic homolog 5 expression, it is possible that miR-155 effects on HGAL expression, RhoA signaling and lymphoma cell motility contributed to the reported observations and may underlie lymphoma aggressiveness and dissemination in patients.

Interestingly, the molecular mechanism underlying miR-155 effects on lymphocyte motility is different in mouse and human cells, and examination of RTKN2 and M17 protein levels suggests that miR-155 is not regulating expression of these proteins in the bic/miR-155^−/− and wild-type C57BL/6J splenocytes. These findings exhibit an example of an identical miRNA biologic effect that is achieved by regulating different target proteins in mice and human cells.

It is well known that miRNAs frequently regulate multiple genes involved in the same biologic process.⁴⁸  Herein we demonstrate that miR-155 regulates HGAL and RTKN2, both controlling RhoA signaling and cell motility. It is possible that additional genes functioning in this process are also direct targets of miR-155. Although down-regulation of both proteins by miR-155 may contribute to the enhancement of lymphoma cell motility, complete rescue of RhoA activation and motility by HGAL missing the 3′-UTR suggests that HGAL may be the major molecular target mediating miR-155 effects on these processes in human lymphocytes.

In conclusion, we demonstrate that miR-155 regulates expression of HGAL and increases motility of malignant lymphocytes. Further studies aimed to identify additional genes regulated by miR-155 and elucidating its pathogenetic role in lymphomagenesis are needed and are in progress.

I.S.L. was supported by the National Institutes of Health (grants CA109335 and CA122105) and the Dwoskin Family and Fidelity foundations.

National Institutes of Health

Contribution: L.N.D. and X.J. designed the study, performed experiments, analyzed the data, and wrote the paper; S.B. and E.C. performed experiments and analyzed the data; K.R. provided reagents and intellectual input; I.S.L. conceptualized the idea of the study, supervised the experiments, analyzed the data, and wrote the paper; and all authors approved the paper.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Izidore S. Lossos, Department of Medicine, Sylvester Comprehensive Cancer Center, University of Miami, 1475 NW 12th Ave, D8-4, Miami, FL 33136; e-mail: ilossos@med.miami.edu.