Immunostimulatory CpG-oligonucleotides cause proliferation, cytokine production, and an immunogenic phenotype in chronic lymphocytic leukemia B cells

After informed written consent, peripheral blood was obtained from 11 patients with a diagnosis of B-CLL, according to clinical and immunophenotypic criteria. Patients were either untreated or had not received cytoreductive chemotherapy for a period of at least 3 months before investigation. At the time of analysis, all patients were clinically stable, free from infectious complications, and undergoing routine clinical outpatient review. For control experiments, blood samples were collected from healthy volunteers.

All ODNs were used single stranded, phosphorothioate stabilized, and synthesized by TibMolBiol (Berlin, Germany). The following ODNs were used: DSP30 (TCGTCGCTGTCTCCGCTTCTTCTTGCC),23 its control DSP30K (TGCTGCCTGTCTCCCCTTCTTCTTGCC),24 pZ2 (CTCCTAGTGGGGGTGTCCTAT),17 1668 (TCCATGACGTTCCTGATGCT),19 and its control 1720 (TCCATGAGCTTCCTGATCCT). All ODNs were used at 2 μM. Murine monoclonal antibodies (mAbs) specific for CD80, CD86, and CD40; FITC conjugated anti-CD40 mAb; PE conjugated anti-CD86 mAb; and appropriate isotype-controls were purchased from Pharmingen. FITC conjugated anti-CD25 mAB, anti-CD54 mAB, anti-CD58 mAB, anti-CD80 mAb, anti-MHC class I mAb, and appropriate isotype controls were purchased from Coulter-Immunotech. NIH3T3 cells stably expressing the human CD40 ligand (CD40LF) were kindly provided by O. Ottmann (Frankfurt, Germany).

Peripheral blood mononuclear cells (PBMNCs) were isolated from heparinized blood samples by centrifugation over a Ficoll-Hypaque layer (Biochrom, FRG) of 1.077 g/mL density. For separation of CLL B-cells, PBMNCs were incubated with anti-CD2 and anti-CD14 magnetic beads (Dynabeads M450, Dynal, Oslo, Norway) according to the manufacturer's instructions. Such prepared B cells from patients with CLL were > 98% pure as assessed by direct immunofluorescence with the use of a Coulter Epics XL (Coulter, Hamburg, Germany). Nonmalignant B cells did not constitute a meaningful fraction of the total cells isolated because 99% of these cells coexpressed CD5 and CD19 before and after stimulation with CpG-ODN. B cells from normal control subjects were separated by positive selection with the use of CD19-coated magnetic beads (Dynal) and Detachabead (Dynal), according to the manufacturer's instructions to a purity of > 98%. T cells for mixed lymphocyte reactions were isolated from PBMNCs by incubation with anti-CD14 and anti-CD19-coated magnetic beads, resulting in > 97% CD2-positive cells.

Purified normal and leukemic B cells were cultured in RPMI 1640 medium (Biochrom, Berlin, Germany), supplemented with 10% fetal calf serum (Biochrom), penicillin/streptomycin 50 IU/mL, Na-pyruvate 1 μmol/L, L-glutamine 2 μmol/L, L-asparagine 20 μg/mL, 2-mercaptoethanol 0.05 μmol/L, HEPES 10 μmol/L, and MEM nonessential amino acids 0.7 × (Biochrom) at 37° and 5% CO₂ in a fully humidified atmosphere in 24 well plates at 10⁶ cells in a total volume of 1 mL. For culture in the CD40 system, 10⁵ CD40LF was irradiated (5000 rad) and seeded as a feeder layer before adding the B cells.

Purified B cells were cultured at 5 × 10⁴ cells/200 μL in round-bottom plates with or without 5 × 10³irradiated CD40LF or ODN for induction of B-cell proliferation. After 72 hours, the cells were pulsed with ³H-thymidine (Du Pont, Paris) and harvested in a PHD-Cell Harvester (Dunn Labortechnik) after 16 hours. Thymidine incorporation was quantified in a ß-counter (Beckmann, Munich).

Along with irradiated B-CLL cells, 2 × 10⁵purified CD3+ T cells were cultured at a 1:2 stimulator to responder ratio for 5-7 days. Before the MLR, B-CLL cells were cultivated with or without ODN, CD40LF, or both for 48 hours. Cells were washed two times, irradiated (2000 rad), and cultivated with freshly separated allogeneic T cells. During the last 16 hours of culture, the cells were pulsed with 1 μCi ³H-thymidine (Du Pont, Paris). For inhibition experiments, anti-CD80 mAb, anti-CD86 mAB, or anti-CD40 mAB were added from the beginning of the culture period.

Cytokine levels were determined with the use of commercially available enzyme-linked immunosorbent assay kits (TNFα and IL-6 Duoset), according to the instructions of the manufacturer (Genzyme, Germany). Each value shown represents the mean of duplicate values.

Cells were washed in PBS containing 2% fetal calf serum and incubated with saturating amounts of fluorochrome-conjugated mAB. After 30 minutes at 4°C, the cells were washed with PBS/2% fetal calf serum and analyzed via flow cytometry with the use of a Coulter Epics XL cytofluorometer, acquiring 5000 events. Data were analyzed with the use of WinMDI 2.7 FACS software. The relative expression of surface antigen is described as the mean fluorescence intensity ratio (MFIR). MFIR equals the MFI of cells stained with a fluorochrome-conjugated antigen-specific mAb divided by the MFI of cells stained with a fluorochrome-conjugated isotype control mAb. MFIR induction was calculated with the use of the equation: MFIR (stimulated)/MFIR (untreated).

Data from individual experiments are presented as mean ± SEM. Statistical significances were determined with the use of the Wilcoxon signed rank test and the Mann-Whitney test, as appropriate. A Pvalue < .05 was considered to be statistically significant. TheP value was adjusted with the use of the Bonferroni-Holm correction when multiple comparisons were performed.

Purified B-CLL cells and normal peripheral blood B cells derived from healthy donors were cultured with the immunostimulatory CpG-ODN DSP30,23 its control CpG-ODN DSP30K (with an inverted GpC motif), and an unmethylated control ODN lacking the CpG dinucleotide (pZ2). In addition, B-CLL cells were stimulated with CD40LF or a combination of CD40LF and CpG-ODN. In all patients with CLL tested, the proliferative response induced by DSP30 was stronger than with its control ODN DSP30K (Figure 1). No thymidine uptake was observed, using the non-CpG-ODN, pZ2. Proliferation of B-CLL cells could be induced with DSP30 at concentrations as low as 20 nmol/L, but the optimal proliferative responses were seen with 2 μmol/L (data not shown). A similar pattern of response was observed with the CpG-ODN 1668 and its control 1720 (data not shown). Ligation of CD40 on B-CLL cells led to a moderate and heterogeneous proliferative response that was strongly enhanced when stimulatory ODNs were added to the culture (Figure 1). This pattern of stimulation was consistently observed with B cells from all patients tested.

Stimulation with DSP30 seemed to induce a stronger response in normal B cells as compared with B-CLL cells, although the difference was not statistically significant (Figure 2). CD40-ligation resulted in a stronger proliferation in normal B cells (P = .002). In malignant but not in normal B cells, the addition of DSP30 strongly enhanced the proliferative response induced by CD40-ligation, resulting in a higher proliferative index in patients with CLL (4.8 ± 1.6; 1.4 ± 0.2, P = 0.03). No induction of thymidine incorporation was seen when CD40LF was cultured with DSP30 alone (data not shown).

Tumor necrosis factor α (TNF-α) release could be detected in response to DSP30 and to a lesser extent to DSP30K. No significant TNF-α production was found when the control ODN pZ2 was used as the only stimulus. Figure 3A shows the results of two independent experiments. Costimulation with DSP30 and CD40LF resulted in a strong increase in cytokine production. A similar but weaker effect was observed when DSP30K was added to co-cultures of B-CLL cells and CD40LF. In contrast to the proliferation data, the ODN pZ2 was able to costimulate TNF-α release in one of the two patients tested (Figure 3B). A similar pattern of response could be observed with interleuken-6 (IL-6) production but no IL-6 release was detected in response to ODN alone in two independent experiments (data not shown). Figure 4A shows TNF-α production of nine patients with CLL and seven normal control subjects in response to DSP30 with or without CD40LF. TNF-α release could be detected in normal and malignant B cells after 48 hours of culture with the CpG-ODN DSP30. However, addition of CpG-ODN DSP30 to co-cultures of CD40LF and B-CLL cells or normal B cells resulted in strongly augmented TNF-α production. Of note, the addition of DSP30 to co-cultures of B-CLL cells and nontransfected 3T3 fibroblasts did not result in increased TNF-α release (data not shown). The pattern of IL-6 production was essentially comparable to TNF-α production. Again, strong synergistic effects of DSP30 and CD40-ligation were observed. In contrast to TNF-α, the IL-6 levels produced by normal B cells were significantly higher compared with B-CLL cells. In fact, only the costimulation of CD40-ligation and DSP30 resulted in measurable levels of IL-6 in B-CLL cells (Figure 4B).

After a 48-hour culture period with either DSP30, CD40LF, or the combination of both, the expression of surface molecules CD40, CD58, CD80, CD86, MHC class I, CD54, and CD95 was examined by FACS analysis. The results of a typical FACS analysis are shown in Figure5. Tables1A and 1Bgive the pooled results from 11 B-CLL samples and 7 normal control samples for MFIR-induction when using DSP30, CD40LF, or both as stimuli. DSP30 stimulation of B-CLL cells and normal B cells up-regulated the expression of CD40, CD54, CD58, CD80, CD86, and MHC class I surface molecules in all samples tested, whereas CD95 expression was not changed. However, DSP30 was significantly stronger in up-regulation of CD40 expression in B-CLL cells (P < .002) as compared with normal B cells (Table 1A vs Table 1B). Overall, the degree of CD58, CD80, CD86, and MHC class I up-regulation was not different when comparing stimulation by CpG-ODN versus CD40-ligation. Compared with CD40-ligation, CpG-ODN was a stronger up-regulator of CD40 (P = .002) in B-CLL cells but not in normal B cells (P = .13). As compared with CpG-ODN, CD40-ligation strongly affected CD54 expression in B-CLL cells (P = .004) and normal B cells (P = .03). Stimulation by co-culture of CpG-ODN and CD40LF resulted in an enhanced up-regulation of CD58, CD80, and CD86 as compared with either stimuli alone in B-CLL cells. Similar effects were observed in normal B cells. Expression of MHC class I molecules was further increased in B-CLL samples but not in normal B cells (Table 1A, 1B). Of note, CD95 was up-regulated by CD40-ligation, but addition of CpG-ODN inhibited CD95 up-regulation in normal B cells (P = .03) and B-CLL cells (P = .004). In accordance with the proliferation assays and cytokine measurements, the control non-CpG-ODN DSP30K induced a similar but weaker response, and the unrelated ODN pZ2 had no effect on surface molecule expression (data not shown).

B-CLL cells are poor stimulator cells in allogeneic mixed lymphocyte reactions. Because CpG-ODN activated B-CLL cells to up-regulate expression of costimulatory molecules, we evaluated whether CpG-ODN activated B-CLL cells could act as stimulator cells in an allogeneic MLR. We also examined the stimulatory capacity of B-CLL cells that had been cultured with CD40LF in the presence or absence of CpG-ODN. After 48 hours of culture, cells were washed twice, irradiated, and co-cultured with freshly isolated allogeneic T cells at a stimulator to responder ratio of 1 : 2. After 5 days, cell proliferation was assessed by incorporation of ³H-thymidine. The results of 4 independent experiments are depicted in Figure6 and show that CpG-ODN-stimulated B-CLL cells were as effective as CD40LF-activated cells in stimulating proliferative responses in allogeneic T cells. Although unstimulated B-CLL cells caused a proliferative index (³H-thymidine incorporation of stimulated T cells/³H-thymidine incorporation of T cells alone) of 3.7 ± 1.5, CpG-ODN-stimulated B-CLL cells caused an index of 13.5 ± 4.1. Overall, CpG-ODN activation was as efficient as activation with CD40LF or with a combination of CD40LF and CpG-ODN (Figure 6). A mitogenic effect of residual DSP30 was excluded because addition of DSP30 to co-cultures of allogeneic T cells and irradiated leucemic B cells did not result in increased proliferation.

The role of B7 costimulatory molecules in inducing an allogeneic T-cell proliferative response toward B-CLL cells activated by CD40-ligation has been described.8 9 Hence, we evaluated whether CpG-ODN-induced expression of B7 costimulatory molecules was responsible for the stimulatory capacity of CpG-ODN-activated B-CLL cells. Inhibition experiments were performed by adding anti-CD80 mAb, anti-CD86 mAB, or a combination of both to the cultures. The addition of anti-CD80 mAb or anti-CD86 mAb to cultures reduced thymidine incorporation by 40%-70%. Combination of both mAbs reduced the proliferative response to baseline levels. Addition of anti-CD40 mAb had no inhibitory effect on T-cell proliferation (data not shown).

In this study, we investigated the potential of immunostimulatory CpG-ODN to induce proliferation, cytokine production, and accessory surface molecule expression in B-CLL cells. DSP30 is a CpG-ODN, containing three CG dinucleotides and has been described as an effective CpG-ODN for human B cells.23 To evaluate the importance of CG motifs, we also used DSP30 K (with inverted CG motifs) and the ODN pZ2 (without CG dinucleotides). Proliferation of B-CLL cells was induced with CpG-ODN DSP30 but some ³H-thymidine incorporation could also be measured with the use of the control ODN DSP30K (Figure 1). Similar results were observed with purified tonsillar B cells stimulated with CpG-ODN.24Because no proliferation was observed in response to the phosphorothioate stabilized ODN pZ2, B-CLL-cell activation must be dependent on specific sequences of CpG-ODNs rather than on the phosphorothioate backbone.23 The mechanism of human B-cell activation by specific ODNs is not clear. Studies in the mouse showed activation of the stress kinase pathway and a strict dependency on the CpG motif.25 This activation has been questioned in human B cells because ODNs lacking the CpG motif were active in inducing B-cell proliferation although the entire CpG was necessary for maximal proliferation. It remains possible that the phosphorothioate backbone used to reduce degradation provides a permissive influence that permits sequence-specific B-cell activation as the diester form of DSP30 has a reduced stimulatory capacity.23 Interestingly, the control ODN DSP30K was able to induce low cytokine production, proliferation, and surface molecule regulation despite lacking the CpG motif, whereas the control-ODN pZ2 was not reactive when used alone but induced cytokine production when used together with CD40LF (Figure 3A, 3B).

In contrast to low responsiveness toward CD40-ligation or crosslinking of the B-cell antigen receptor complex,2,26 the proliferative response of B-CLL cells stimulated by DSP30 was similar to that of normal B cells. Addition of DSP30 to co-cultures with CD40LF resulted in a fivefold increase of thymidine incorporation in B-CLL cells but not in normal B cells. These data suggest that hyporesponsiveness of B-CLL cells to CD40-ligation can, at least in part, be overcome by CpG-ODN (Figure 2A). The following 2 mechanisms might be involved: (1) up-regulation of CD40 is significantly enhanced in B-CLL cells as compared with normal B cells, which may allow a stronger signaling via CD40-ligation; and (2) the increased TNF-α production achieved via costimulation with CD40-ligation and CpG-ODN may stimulate B-CLL cells in an autocrine fashion (Figure 3B, 4A). Autocrine stimulation by TNF-α has been described previously for malignant B cells.27 28 

CpG-ODN rapidly activate murine B cells to secrete IL-6,29and high levels of TNF-α can be detected in cultures of CpG-activated murine and human monocytes.15,24 To date, production of IL-6 and TNF-α has not been described by CpG-ODN-activated human B cells. Interestingly, IL-6, which is thought to inhibit the growth of B-CLL cells,30 is produced only in low amounts by B-CLL cells (Figure 4B). In fact, only costimulation with CpG-ODN and CD40LF resulted in measurable levels of IL-6. The reduced potential of B-CLL cells to produce IL-6 has been postulated to play a role in B-CLL progression and in clinical manifestations of the disease.31 

Enhanced expression of accessory molecules, such as CD40, CD86, and MHC class I molecules, has been described in human monocytes, tonsillar B cells,24 and B cells separated from PBMC.23Here, we investigated the potential of CpG-ODN to regulate the expression of costimulatory molecules and molecules involved in B-cell T-cell interaction that are known to be expressed on B lymphocytes from chronic B-cell malignancies.32 In contrast to the CD40 antigen that is known to play a central role in T-cell-mediated B-cell activation,33 CD95, another member of the TNF receptor superfamily, was not modulated by CpG-ODN. In fact, CD40LF induced enhanced CD95 expression was inhibited when DSP30 was added to co-cultures of CD40LF and normal B cells or B-CLL cells (Table 1A, 1B). CpG-ODN-activated murine B-lymphocytes are protected against FAS-mediated apoptosis, possibly via down-regulation of CD40-ligation-induced CD95-expression.20 However, B-CLL cells are resistant to FAS-mediated apoptosis,34 35 and we observed no difference in the propensity to apoptosis on adding an agonistic FAS antibody to B-CLL cells activated with CD40LF in the presence or absence of CpG-ODN (unpublished data).

CpG-ODN triggered a strong and consistent up-regulation of CD40, CD80, CD86, CD54, MHC class I, and CD58 surface molecules in B-CLL cells. All these molecules have been described to be of major importance for professional APC function.7,36-38Accordingly, CpG-ODN-activated B-CLL cells proved to be as effective in inducing allogeneic T-cell proliferation as B-CLL cells after CD40-ligation. In spite of the increased expression of B7-costimulatory molecules in cells stimulated with CD40LF and CpG ODN, no further increase in proliferation of allogeneic T cells was noted (Figure 6). As described for the MLR between allogeneic T cells and CD40-stimulated B-CLL cells,9 allogeneic T-cell proliferation could be inhibited with the use of a combination of anti-CD80 and anti-CD86 mAb.

Prior studies have demonstrated the potential for immunotherapy, using tumor cells expressing the accessory molecules CD80 and CD86.39,40 CD40-ligation has been used to up-regulate CD80 and CD86 molecules in chronic lymphocytic leukemia cells,9follicular lymphoma cells,41 and acute lymphoblastic leukemia cells.42 Kato et al10 have demonstrated that CD154 transfection of B-CLL cells is associated with up-regulation of B7 costimulatory molecules in bystander leukemia B cells. With the use of this approach, generation of autologous cytotoxic T lymphocytes has been achieved,10 and the results from therapeutic application of CD154-transfected cells have been presented recently.11 In view of these data, our results suggest the possibility of using CpG-ODN-activated B-CLL cells to generate autologous T-cell responses. The strong and consistent up-regulation of costimulatory molecules, the costimulatory effect of CpG-ODN with CD40-ligation, and the possibility of stimulating cells in vitro and in vivo suggest CpG-ODN as an attractive addition to immunotherapeutic strategies in CLL.

We thank K. Götze and W. Spelsberg for critically reading the manuscript.