Homozygous truncation of the fibrinogen Aα chain within the coiled coil causes congenital afibrinogenemia

Fibrin is the major protein constituent of the hemostatic plug. It is formed by limited proteolysis of the precursor fibrinogen and spontaneously forms polymers that condense to become the fibrin clot. Fibrin also binds to platelets and components of the extracellular matrix and undergoes cross-linking by factor XIIIa to stabilize the plug. Given this central role in hemostasis, it is somewhat surprising that congenital deficiency of fibrinogen, which has been described in more than 150 families, results in a coagulation defect that is typically no more severe than hemophilia.1Uncontrolled bleeding from the umbilical cord is a common presenting feature, and spontaneous intracerebral hemorrhage or splenic rupture can occur throughout life. There is often significant bleeding after even minor trauma, but patients respond well to fibrinogen replacement therapy.

Fibrinogen is a complex glycoprotein consisting of 3 homologous polypeptide chains, Aα, Bβ, and γ, which form a symmetrical dimer with the structure (Aα Bβ γ)₂. Three separate genes encode the chains in a single 50-kilobase (kb) cluster.2Synthesis is controlled at the level of transcription by regulatory sequences located adjacent to each gene, ensuring coordinated chain synthesis. Fibrinogen assembly appears to be limited by the availability of Bβ chains, the transcription of which may be increased by a number of factors, including acute inflammation and trauma.3 

A small number of studies have described the molecular basis for moderate to severe hypofibrinogenemia. These patients have truncations of the Aα chain gene and may present with a clinical picture resembling afibrinogenemia.4-6 However, true afibrinogenemia has only recently been characterized at the molecular level.7 Here we report the investigation of a new patient with a moderate to severe bleeding disorder due to congenital afibrinogenemia and describe the identification of a novel mutation (Aα 149 Arg→stop) that predicts the early truncation of the Aα chain.

Plasma fibrinogen was determined according to the method of Clauss.8 Thrombin and reptilase clotting times were determined using reagents and methods supplied by the manufacturer (Nycomed-Pharma, Uppsala, Sweden).

Washed platelets were isolated from platelet-rich plasma as described by Solum et al9 and dissolved in 1% Triton X-100 to a final density of 1010 cells/mL. A total of 100 μL of plasma or Triton X-100–solubilized platelets was applied under suction to a 0.45-μm nitrocellulose membrane (Bio-Rad, Carlsbad, CA) using a dot blot apparatus (Schleicher and Schuell, Dassel, Germany). Plasma and platelets from a healthy individual were used as controls. Wells were flushed with 100 volumes of saline under suction followed by addition of either (1) polyclonal rabbit antihuman fibrinogen, (2) monoclonal antibody to Aα chain (F-103, a gift from Wilhelm Nieuwenhuizen, Gaubius Inst. TNO, Leiden, Holland), (3) monoclonal antibody to Bβ chain 1 to 42 (Accurate Chemical and Scientific Company, Westbury, NY), or (4) monoclonal antibody to γ chain (J88b, a gift from Patricia Simpson Haidaris, University of Rochester, NY). After flushing as above, appropriate secondary antibodies conjugated with alkaline phosphatase were added and the wells developed with BCIP/NBT (Sigma-Aldrich, St Louis, MO).

Genomic DNA was isolated from buffy coat by a standard procedure,10 and the coding regions and flanking intronic sequences of the Aα gene were amplified 11 and cycle-sequenced. Details of primers and polymerase chain reaction (PCR) conditions will be supplied upon request. PCR products were purified using HiPure PCR purification cartridges (Boehringer Mannheim, Mannheim, Germany). Cycle sequencing was performed with either amplification primer using³³P-radiolabeled dideoxy-terminators and Thermosequenase (Amersham, Amersham, UK) according to the manufacturer's instructions. To simplify screening of the extended family, a mutagenic PCR primer was designed to amplify a 118–base pair (bp) segment of exon 4 and introduce a BsrDI site if the Aα 149 R→stop mutation was present. This primer (TTAGAGCTCAGTTGGTTATATGCAA) had a single mismatched base (underlined). Following amplification, the product was digested with 2 units of BsrDI (New England Biolabs, Beverly, MA) for 2 hours at 60°C according to the manufacturer's recommendations and the products separated on 3% Nusieve/agarose (3:1) (FMC Bioproducts, Rockland, ME).

The proposita, a 29-year-old Norwegian woman, was originally diagnosed after exchange transfusions were required following bleeding complications at birth. Investigations at that time showed incoagulable blood, infinite thrombin clotting time, and no immunologically detectable fibrinogen. Other clotting factors, including von Willebrand factor (vWF) (110%), and platelet count (220 × 10⁹/L) were normal. Her bleeding time has varied between 8 and 15 minutes, most often around the upper normal limit, and the tourniquet test has been negative throughout. Platelet aggregation (Born technique) was significantly reduced irrespective of agonist and was entirely absent with adrenaline, although cooperation with trace amounts of adenosine diphosphate (ADP) was present. Small amounts of normal fibrinogen restored the response to both ADP and adrenaline, indicating that adrenaline was unable to initiate vWF binding to platelets.

She has had numerous bleeding episodes consisting mostly of posttraumatic bruising. Bleeding in the ankles led to a recent synovectomy, but other joints have not been affected. However, 3 gastrointestinal bleeds were nearly fatal. Treatment has consisted of on-demand cryoprecipitate. She leads an active life and largely manages her own coagulation treatment, carrying cryoprecipitate with her, which she has self-administered since the age of 12. On average, 2 10-mL injections per month are required, each consisting of 430 IU of vWF, 11 IU of factor VIII, and 200 to 300 mg of fibrinogen. Tranexamic acid was discontinued some years ago because it had little additional effect.

Standard fibrinogen assays failed to detect any measurable quantity of plasma fibrinogen. Dot blotting of plasma fibrinogen was also negative, while dot blotting of Triton X-100–solubilized platelets was slightly positive with a polyclonal antihuman fibrinogen antibody and a monoclonal antibody toward fibrinogen γ chain (not shown). Dot blots reacted with monoclonal antibodies to both Aα and Bβ chains were negative. It may therefore be concluded that her platelets contain tiny amounts of fibrinogen γ chain.

The finding of no detectable functional fibrinogen in this woman raises the question of how hemostasis is maintained in its absence. This is probably due to vWF, which acts as a stand-in ligand in platelet aggregation, allowing afibrinogenemic patients to survive. This large multifunctional protein is even more important in hemostasis through its essential role in platelet adhesion. The adhesive effect increases with increasing shear and favors hemostasis in small vessels where a high shear prevails. This explains why bleeding time and tendency is only moderately affected in afibrinogenemia, even though no clot can be formed.

The entire coding region and flanking intronic sequences of the Aα chain gene were sequenced. Analysis of the noncoding strand of exon 4 showed that the proposita was homozygous for a G-to-A transition (Figure 1), which corresponds to a C-to-U transition at nucleotide 557 of the messenger RNA. This transition predicts the change of codon 149 from R (CGA) to a stop codon (UGA), which would result in the production of a severely truncated Aα chain. Because this mutation convincingly accounted for the patient's disease and the recessive mode of inheritance, sequencing of the remaining fibrinogen genes was abandoned. As expected, sequencing of amplified DNA from the patient's father showed that he was heterozygous for the same Aα 149 R→stop mutation (Figure 1). Sodium dodecyl sulfate–polyacrylamide gel electrophoresis of purified plasma fibrinogen, however, revealed a normal pattern of chains with no trace of the truncated Aα chain present.

PCR amplification with a mutagenic primer designed to create aBsrDI site in the presence of the mutation showed, as expected, that the mother was also heterozygous, along with 5 of 14 other family members who were tested. Despite being heterozygous, her mother and father had normal fibrinogen concentrations of 2.4 and 1.8 mg/mL, respectively (normal range, 1.5-4 mg/mL). Interestingly, they have a common great-great grandmother. Figure 2shows the last 3 generations of the family together with the available coagulation data. Although the mean plasma fibrinogen of carriers is 2.07 g/L versus 2.43 g/L for noncarriers, it is obvious that plasma fibrinogen concentration is not a useful indicator of carrier status.

By comparing fibrinogens with congenitally truncated Aα chains to fibrinogens with acquired Aα chain truncations, it appears that hypofibrinogenemia must result from defective assembly or secretion rather than from decreased circulatory half-life. For example, LMW′ (low molecular weight′) fibrinogen, produced in circulation by cleavage of both Aα chains at asparagine 269,12 has only a 50% reduction in plasma half-life.13 In contrast, the similar-sized genetic variant fibrinogen Otago, in which truncation occurs at residue 270, has less than 5% of the normal plasma fibrinogen concentration.4 

Two mechanisms might account for the low levels in genetic variants. First, a moderately truncated Aα chain may have a shortened intracellular half-life so that the availability of Aα chains becomes limiting. Alternatively, a truncated Aα chain may be functionally lacking in a region critical to the stability of the 2-chain or 3-chain intermediate.

Structurally, the Aα chain may be viewed as being composed of 3 elements: (1) the portion that contributes to the N-terminal disulfide knot, (2) the coiled coil (residues 45-165), which is bounded by disulfide rings at either end, and (3) the extended C-terminal segment terminating in the globular αC domain.

Some homozygous C-terminal truncations of the Aα chain have been characterized. The truncation after residue Aα461 in fibrinogen Marburg results in marked hypofibrinogenemia with immunologically determined concentrations of 0.6 mg/mL,5 while the truncation after residue Aα270 in fibrinogen Otago produces a more severe hypofibrinogenemia with concentrations of only 0.1 mg/mL.4 In contrast, the truncation after residue Aα454 in fibrinogen Milano III does not result in hypofibrinogenemia even though it occurs within 10 residues of the Marburg truncation. However, this patient presented with elevated levels of anticardiolipin immunoglobulin M consistent with systemic lupus erythematosus, which could explain the higher fibrinogen levels.6 Studies in recombinant expression systems support a role for the C-terminal Aα chain in assembly and secretion. Secretion in a CHO expression system of a recombinant fibrinogen with a truncation introduced after Aα251 was 5- to 10-fold lower than that of the normal protein,14whereas a Bβ chain truncated at Bβ208 supported normal fibrinogen secretion from transiently expressing COS cells.15 Importantly, both of these constructs retained the coiled coil region.

An early Aα chain truncation has been identified in another case of afibrinogenemia.16 The structural feature that is missing in this and the present case, but not in the hypofibrinogenemias described above, is at least part of the coiled coil domain, including the C-terminal disulfide ring. This is one of 2 rings that stabilize the coiled coil structure connecting the central E domain to the peripheral D domains. Xu et al17 examined the importance of residues in this region in the fibrinogen assembly process and showed that the distal segment of the coiled coil region is critical in ordering the assembly process. The importance of disulfide formation in fibrinogen assembly has also been examined. Zhang and Redman found that C-terminal intrachain disulfide bridges were not critical for assembly18 but that intact interchain disulfide rings were required for secretion of mature fibrinogen from transiently transfected COS cells.19 The finding of afibrinogenemia in an individual with Aα chains truncated at residue 148, but hypofibrinogenemia in an individual with Aα chains truncated at residue 270, entirely supports these studies. Together, these mutations define in vivo the minimum Aα chain length necessary for supporting the assembly and secretion of a stable fibrinogen molecule.