Integrin α_Dβ₂, an adhesion receptor up-regulated on macrophage foam cells, exhibits multiligand-binding properties

Integrins are ubiquitous α/β heterodimeric adhesion receptors that mediate cell-cell and cell-extracellular-matrix (ECM) interactions. The subfamily of β₂ integrins comprises a monophyletic group of closely related glycoproteins critically involved in leukocyte adhesion and migration during the inflammatory immune responses. The group consists of 4 members, α_Lβ₂ (LFA-1, CD11a/CD18), α_Mβ₂ (Mac-1, CD11b/CD18), α_Xβ₂ (p150,95, CD11c/CD18), and α_Dβ₂ (CD11d/CD18). These integrins are assembled as a group on the basis of their common β₂ subunit and their expression restricted to leukocytes. Whereas structure-function relationships of 3 integrins, α_Lβ₂, α_Mβ₂, and α_Xβ₂, have been the subjects of intensive research, the ligand-binding specificity and pathophysiologic roles of the most recently discovered integrin α_Dβ₂¹  are poorly understood. Like 2 other highly related β₂ integrins, α_Mβ₂ and α_Xβ₂, integrin α_Dβ₂ is expressed on myeloid cells such as monocytes and neutrophils. However, the pattern of expression of this integrin is unique among other myeloid cell-specific β₂ integrins in that α_Dβ₂ is expressed poorly on peripheral blood leukocytes but strongly on macrophage foam cells within atherosclerotic plaques.^1,2  In contrast, the major myeloid-specific integrin α_Mβ₂ is progressively up-regulated on circulating neutrophils and monocytes in response to chemotactic stimulation^3,4  and is down-regulated in lesion-derived macrophages.⁵  The significance of the up-regulation of α_Dβ₂ in monocyte-derived cells from atherosclerotic lesions is not known. The role of high levels of α_Dβ₂ in these cells may become clear if the ligands with which this integrin interacts are defined. Previous studies demonstrated that α_Dβ₂ is capable of binding vascular cell adhesion molecule 1 (VCAM-1)^6,7  and intercellular adhesion molecule 3 (ICAM-3).¹  VCAM-1 is present on endothelial cells and, thus, clearly absent from the extravascular compartment in which formation of foam cells occurs. ICAM-3 is present on lymphocytes that are detectable in atherosclerotic lesions (for a review, see Getz⁸ ). However, recruitment of monocytes into atherogenic foci and their retention within lesions would require cell interactions with their surroundings. Yet, essentially nothing is known about the interaction of α_Dβ₂ with the ECM proteins.

It is well documented that the interactions of β₂ integrins with ligands are mediated by their I-domains, the regions of about 180 amino acid residues inserted into the β-propeller of α subunits.⁹  The α_DI-domain is highly homologous to the α_MI-domain with 60% of its amino acid sequence being identical. A distinctive feature of integrin α_Mβ₂ is its ability to bind numerous structurally diverse ligands, including many ECM proteins (reviewed in part by Yakubenko et al¹⁰ ). We have previously demonstrated that within the α_MI-domain, the α_M(Lys²⁴⁵-Arg²⁶¹) segment contributes to the binding of many ligands.¹⁰  This segment forms the (βD-α5)-loop/α5-helix in the 3-dimensional structure of the α_MI-domain¹¹  and is the site of the major structure and sequence divergence between the α_MI-domain and the α_LI-domain, an integrin with a narrow ligand-binding specificity and that binds only ICAMs.¹²  We have noted that the α_MI-domain region α_M(Lys²⁴⁵-Arg²⁶¹) and its homolog, Lys²⁴⁴-Lys²⁶⁰ in the α_DI-domain, have 59% identical and 12% conserved residues (Figure 1). Furthermore, 4 residues in the α_M sequence, Asp²⁴⁸, Tyr²⁵², Asp²⁵⁴, and Pro²⁵⁷, which were shown to be critical for ligand binding by α_Mβ₂,^13,14  are present in the α_DI-domain. Given these similarities, we hypothesized that α_Dβ₂ and α_Mβ₂ have overlapping recognition specificity and that the region in the α_DI-domain homologous to α_M(Lys²⁴⁵-Arg²⁶¹) is involved in ligand binding.

In the present study, we have examined the molecular basis for ligand binding by integrin α_Dβ₂. We have generated α_Dβ₂-expressing cells and demonstrated that they are capable of binding many ECM proteins with specificity overlapping that of α_Mβ₂, a finding that places α_Dβ₂ into the category of multiligand receptors. Furthermore, we have shown that the mechanism whereby α_Dβ₂ exhibits promiscuity in ligand binding is like that used by α_Mβ₂.

Human fibrinogen was obtained from Enzyme Research Laboratories (South Bend, IN). Fibronectin was isolated from fresh human plasma by gelatin-agarose affinity chromatography.¹⁵  Vitronectin was isolated from outdated plasma treated with 8 M urea using heparin-agarose affinity chromatography.¹⁶  Plasminogen was purified from human plasma using lysine-agarose affinity chromatography followed by gel filtration as described.¹⁷  Recombinant cysteine-rich angiogenic inducer (Cyr61) was a generous gift from Dr S. Lam (University of Illinois, Chicago, IL). VCAM-1 and ICAM-3 were purchased from R&D Systems (Minneapolis, MN). The P2-C peptide (TMKIIPFNRLTIG), corresponding to the fibrinogen sequence γ383-395, was synthesized and purified as described.¹⁸  The monoclonal antibody (mAb) IB4 directed against the β₂-integrin subunit and rat mAb 1/70, which recognizes mouse α_M integrin subunit, were purified from the conditioned media of the hybridoma cell line obtained from American Tissue Culture Collection (ATCC; Manassas, VA) using protein A agarose (Amersham Biosciences, Piscataway, NJ). Polyclonal antibody 1950 directed against the β₁-integrin subunit was purchased from Chemicon (Temecula, CA). Polyclonal antibody against the α_DI-domain was generated by BioSource International (Camarillo, CA) using recombinant α_DI-domain as an immunogen. The antibody was isolated from rabbit serum by precipitation with 35% ammonium sulfate and then purified by affinity chromatography using α_DI-domain-Sepharose. The polyclonal antibody recognizes both human and mouse α_DI-domains and has no cross-reactivity with the α_M-integrin subunits (V.P.Y., unpublished data, May 2004). Purified rabbit, mouse, and rat IgG were purchased from Sigma (St Louis, MO).

Two recombinant α_DI-domains, the “active” and “nonactive,” were expressed in Escherichia coli. The cDNA encoding the “active” α_DI-domain (residues Pro¹²⁸-Lys³¹⁴) was generated by polymerase chain reaction (PCR) from a randomly primed cDNA library of the U937 monocytoid cell line. A PCR fragment was digested with NdeI and XhoI and inserted into the pET-15b vector (Novagen, Madison, WI). The α_DI-domain as a His-tag fusion protein containing 6 His residues at its NH₂ terminus was purified from a soluble fraction of E coli lysates using affinity chromatography on Ni-chelating agarose (Qiagen, Valencia, CA). To express the “nonactive” α_DI-domain (residues Pro¹²⁸-Ala³²³), the cDNA coding this region was amplified from the U937 cell library and inserted into the PGEX-4T-1 vector (Amersham Biosciences) using EcoRI and XhoI sites for expression in E coli BL-21(DE3) pLysS cells. The α_DI-domain as a fusion with GST was purified from a soluble fraction of E coli lysates using affinity chromatography on glutathione agarose essentially as described.¹⁴  The GST component was removed by cleavage with thrombin as described. The “active” α_LI-domain, originally described by Lu et al,¹⁹  was prepared using the previously created α_L-PGEX4T-1 construct (Gly¹²⁸-Tyr³⁰⁷)¹⁴  as a framework. In the new construct, 2 lysines, Lys²⁸⁷ and Lys²⁹⁴, were substituted to cysteines to create a disulfide bond and, thus, lock the protein in the active conformation. Mutations were introduced using the QuickChange site-directed mutagenesis kit from Stratagene (La Jolla, CA) according to the manufacturer's instructions. The α_LI-domain as a fusion with GST was purified from a soluble fraction of E coli using affinity chromatography on glutathione agarose and its fusion part removed by thrombin.

To generate the α_L(α_DLys²⁴⁴-Lys²⁶⁰) I-domain chimera, the segment corresponding to the α_LI-domain sequence Ala²⁴²-Asp²⁵¹ was changed to the homologous segment of the α_DI-domain Lys²⁴⁴-Lys²⁶⁰. A segment switch was created by oligonucleotide-directed mutagenesis using PCR. The construction of the chimera was based on the observation that oligonucleotide sequence encoding α_D Lys²⁴⁴-Lys²⁶⁰ contains a unique restriction site for XbaI. Therefore, designed mutagenic primers contained nucleotide sequence for the α_DLys²⁴⁴-Lys²⁶⁰ segment and additional unchanged α_L bases: 5′-CCTCTAGAATACAGTGACGTCATCCCCCAGGCAGAGAAGAAAGACATCATCCGCTACATCATC (forward), 5′-GTATTCTAGAGGGTCTTTGTACTTCTCCCCATCCGTGATGATGATAAGCAC (reverse); the α_D sequences are in italics and the restriction site for XbaI is underlined. The pGEX-4T-1 vector containing the cDNA encoding the “active” α_LI-domain was modified by PCR using PfuTurbo DNA polymerase with the following cycling parameters: 95°C for 30 seconds, 55°C for 1 minute, and 68°C for 11.5 minutes. Following temperature cycling, the product was treated with DpnI to digest the parental DNA template. The linear product was purified and digested with XbaI to produce a cDNA fragment with cohesive ends. These fragments were ligated and transformed into BL-21(DE3)pLysS E coli-competent cells. The accuracy of the DNA sequence was verified by sequencing. The chimeric I-domain as fusion with GST was expressed and purified following the procedure described for the wild-type I-domains.

The IC-21 macrophage cell line was obtained from the ATCC (Rockville, MD). Cells were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA) supplemented with 10% FBS, 0.1 mg/mL streptomycin, 0.1 U/mL penicillin, and 2 mM l-glutamine. The α_Mβ₂-expressing and mock-transfected HEK 293 cells¹⁰  were maintained in DMEM/F-12 (Gibco) supplemented with 10% FBS, 2 mM glutamine, 15 mM HEPES, 0.1 mg/mL streptomycin, and 0.1 U/mL penicillin. The cDNA encoding the β₂-integrin subunit was generated as previously described.¹⁰  The full-length cDNA of the α_D-integrin subunit was cloned from a human U937 monocytoid cell line cDNA library. The library was synthesized from total cellular RNA using SuperScriptII reverse transcriptase (Invitrogen) as described previously.²⁰  The α_D cDNA was cloned into pcDNA3.1/Neo(-) vector and the β₂ cDNA was cloned into pcDNA3.1/Hygro(-) vector (Invitrogen). HEK 293 cells were stably transfected with pcDNA3.1 plasmids with inserted α_D and β₂ using LipofectAMINE 2000 reagent (Invitrogen). After 48 hours at 37°C in 5% CO₂, cells were harvested and cultured in medium with 500 μg/mL G418 (Invitrogen) and 250 μg/mL Hygromycin (Invitrogen). After 14 days, surviving cells were collected, sorted, and analyzed using flow cytometry and immunoprecipitation.

Fluorescence-activated cell sorting (FACS) analyses were performed to assess the expression of receptors on the surface of the cells transfected with α_Dβ₂ integrin. The cells were incubated with anti-α_D polyclonal antibody and anti-β₂ mAb IB4 and analyzed using a FACScan (Becton Dickinson, San Jose, CA) as described.¹⁰  Populations of cells expressing similar amounts of α_Mβ₂ and α_Dβ₂ were selected by FACS using a BD Biosciences (San Jose, CA) FACS Vantage Instrument.

Cells (5 × 10⁶) were labeled with 100 μg Immunopure Sulfo-NHS-LC-Biotin (Pierce, Rockford, IL) in 200 μL PBS for 30 minutes at 22°C. The cells were solubilized with a lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM CaCl₂, 1 mM PMSF, 100 μg/mL leupeptin, 10 mM benzamidine) for 30 minutes at 22°C. The lysates were incubated with 10 μg normal mouse IgG (Sigma) and 50 μL Zysorbin-G (Zymed, San Francisco, CA) for 2 hours at 4°C. After centrifugation, the supernatant was incubated with 10 μg mAb IB4 (anti-β₂) for 2 hours at 4°C. The integrin-mAb complex was captured by incubating with 50 μL protein A-Sepharose (Amersham Biosciences) for 2 hours at 4°C. The immunoprecipitated proteins were eluted with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer and analyzed by Western blotting. The Immobilon-P membranes (Millipore, New Bedford, MA) were incubated with streptavidin conjugated to horseradish peroxidase and developed using enhanced SuperSignal Chemiluminescent Substrate (Pierce).

For adhesion assays, 96-wells tissue culture plates (Costar, Cambridge, MA) were coated with different concentrations of fibrinogen, fibronectin, vitronectin, plasminogen, Cyr61, and VCAM-1 for 3 hours at 37°C. The wells were post-coated with 0.5% PVA for 1 hour at 22°C. Cells in DMEM/F-12 were labeled with 10 μM calcein AM (Molecular Probes, Eugene, OR) and assays were performed as described previously.^10,21 

Cell migration assays with calcein-labeled IC-21 cells were performed under sterile conditions using uncoated Transwell inserts with a pore size of 8 μm and 6.5 mm in diameter (Costar, Corning, NY) as described.²¹  Briefly, the lower chambers contained 600 μL of 10 μg/mL vitronectin. Cells (150 μL) in DMEM/F-12 at a concentration of 2.5 × 10⁶/mL were placed in the upper chamber and allowed to migrate for 18 hours at 37°C in 5% CO₂.Two hours prior to the completion of the migration assay, calcein AM was added to the lower chamber to label cells. Assays were stopped by removing cells from the upper surface of the polycarbonate membrane. Cells migrating to the bottom of the filter were detected using a CytoFluorII fluorescence plate reader (Applied Biosystems, Farmington, MA).

The interaction between the I-domains and various ligands was measured using surface plasmon resonance (SPR) using a Biacore 3000 instrument (Biacore, Uppsala, Sweden). Vitronectin, fibrinogen, fibronectin, Cyr61, plasminogen, VCAM-1, and ICAM-3 were covalently coupled via primary amines, at concentrations ranging between about 1000 and 2000 response units, to the dextran matrix of CM5 sensor chips. Different concentrations of the I-domains in HBS-P buffer (Biacore) supplemented with 1 mM MgCl₂ were flowed over cells containing various ligands. All data were corrected for the response obtained using a blank reference flow cell that was activated with EDC/NHS and then blocked with ethanolamine. Steady-state experiments were performed by injecting the analytes at 10 μL/min for 3 minutes. The chip surface was regenerated using 2 M NaCl plus 50 mM NaOH. Data were analyzed using the BIAevaluation 3.1 program (BiaCore, Uppsala, Sweden).

To search for potential α_Dβ₂ ligands, we have generated a cell line expressing this integrin. HEK 293 cells were cotransfected with the wild-type α_D and β₂ and stable transfectants were established. FACS analyses using antibodies specific for the integrin subunits demonstrated similar levels of expression of α_D and β₂ (Figure 2A). Heterodimer association of the integrin was evaluated by immunoprecipitation of detergent-lysed surface-labeled cells (Figure 2B). Anti-β₂-specific mAb IB4 immunoprecipitated both the α_D (molecular weight [MW], 150 kDa) and β₂ (MW, 100 kDa) subunits from cells, indicating that they are associated on the cell surface.

To test the possibility that the recognition specificity of α_Dβ₂ overlaps with that of the related integrin α_Mβ₂, we have investigated the ability of the α_Dβ₂-expressing cells to adhere to several EMC proteins that represent well-characterized α_Mβ₂ ligands. These included: (1) the ECM proteins fibronectin, vitronectin, and fibrinogen, and (2) the proteins Cyr61 and plasminogen, which are overexpressed or become ECM-associated during the inflammatory responses.^22,23  Furthermore, cell adhesion to VCAM-1 was tested because it represents an established α_Dβ₂ ligand.¹  Additionally, cell adhesion to the fibrinogen P2-C peptide, which duplicates the binding site for α_Mβ₂ in fibrinogen²⁴  and contains the generic recognition information required for α_Mβ₂ binding,²⁵  was examined. Naked plastic, which typifies the ability of α_Mβ₂ to stick to many unrelated proteins, was also tested. Figure 3 illustrates that the α_Dβ₂-expressing HEK 293 cells adhered to wells coated with all selected ligands and that comparable levels of α_Dβ₂- and α_Mβ₂-expressing HEK 293 cells attached to each protein. In this figure, maximal cell adhesion to each ligand is shown as obtained from the dose-dependent curves, and the data are expressed as a percentage of added cells. α_Dβ₂ supported efficient adhesion to vitronectin, fibronectin, Cyr61, plasminogen, and P2-C similar to α_Mβ₂. α_Dβ₂-mediated adhesion to fibrinogen was slightly lower than that mediated by α_Mβ₂. By contrast, the α_Dβ₂-expressing cells adhered better to uncoated plastic than the α_Mβ₂-expressing cells. Because cells expressing similar levels of α_Dβ₂ and α_Mβ₂ were used in these experiments, the difference in adhesion may reflect a stronger affinity of α_Dβ₂ to plastic. In control experiments, mock-transfected HEK 293 cells adhered poorly to fibrinogen, Cyr61, and plasminogen, as expected.^18,26,27  These cells adhered to a lower extent to fibronectin,²¹  vitronectin, and VCAM-1, consistent with the presence of endogenous β₁ integrins (see next paragraph).

HEK 293 cells express other integrins, particularly those that belong to the β₁ group²¹  and that are known to bind the ECM proteins. For example, integrin α₅β₁ binds fibronectin,²⁸  α₄β₁ mediates adhesion to VCAM-1,^29,30  and α₆β₁ was shown recently to bind Cyr61.³¹  To determine the contribution of β₁ integrins to adhesion mediated by the α_Dβ₂-expressing HEK 293 cells, we performed adhesion experiments in the presence of anti-β₁, anti-α_D, and anti-β₂ function-blocking antibodies. As shown in Figure 4, no inhibition of adhesion by anti-β₁ polyclonal antibody to Cyr61, fibrinogen, vitronectin, plasminogen, P2-C, and uncoated plastic (not shown) was detected, suggesting that cell attachment to these substrates was entirely α_Dβ₂-dependent. In agreement with these results, anti-α_D polyclonal antibody blocked cell adhesion to these proteins by about 90% (except vitronectin, to which it blocked adhesion by 55%). Nevertheless, the combination of anti-β₁ and anti-α_D (or anti-β₁ plus anti-β₂) antibodies completely blocked cell adhesion to vitronectin. In contrast, anti-β₁ antibody inhibited adhesion to fibronectin and VCAM-1 by about 50% to 55%, indicating that endogenous α₅β₁ and α₄β₁, respectively, on the α_Dβ₂-expressing cells contribute to adhesion. At the same time, anti-α_D alone was a poor inhibitor of cell adhesion; it did not inhibit adhesion to fibronectin and produced only about 15% inhibition of cell adhesion to VCAM-1. However, the combination of anti-β₁ and either anti-α_D or anti-β₂ antibodies effectively inhibited cell adhesion to these ligands, illustrating the contribution of α_Dβ₂. Neither control rabbit nor mouse IgG inhibited cell adhesion (not shown). Taken together, these observations indicate that α_Dβ₂ is capable of engaging many ECM proteins during cell adhesion and suggest that the recognition specificity of α_Dβ₂ is similar to that exhibited by α_Mβ₂.

Further evidence for the similarity of ligand specificity of integrins α_Dβ₂ and α_Mβ₂ was obtained in inhibition experiments using soluble peptide P2-C. We previously reported that P2-C inhibits α_Mβ₂-mediated cell adhesion not only to the γC domain of fibrinogen, from which this sequence is derived, but also to other fibrinogen domains³²  and to many unrelated proteins (Valeryi Lishko, unpublished data, June 2002).^27,33  P2-C was also an effective inhibitor of α_Dβ₂-mediated cell adhesion to vitronectin, fibrinogen, plasminogen, and VCAM-1 (Table 1). Whereas cell adhesion to fibronectin and Cyr61 was less sensitive to inhibition, it was blocked by a combination of P2-C and anti-β₁ antibody. These results clearly show that within ECM proteins, α_Dβ₂ binds sequences that contain recognition information resembling that of the α_Mβ₂ recognition peptide P2-C.

To extend our findings with transfected cells, we examined the ability of macrophage cell line IC-21 to bind various ECM proteins. As assessed by flow cytometry analyses (Figure 5A), unstimulated cultured cells express both integrins α_Mβ₂ and α_Dβ₂, with the latter receptor being expressed at a slightly higher level (1.3-fold). IC-21 cells adhered strongly and in a concentration-dependent manner to various ECM proteins (not shown). To determine a relative contribution of the integrins on macrophages to this adhesion process, we examined the effect of antibodies directed against anti-α_M and anti-α_D integrin subunits. Table 2 shows that individual antibodies exerted partial inhibition of adhesion. However, the combination of 2 antibodies effectively inhibited adhesion to selected ECM proteins by 45% to 65%. In parallel experiments, natural macrophages elicited by thioglycollate injection and isolated from the mouse peritoneal cavities efficiently adhered to the ECM proteins in an α_Dβ₂-dependent manner and no inhibition of adhesion by control rabbit or rat IgG was detected (not shown).

Previous studies demonstrated that α_Mβ₂ is capable of promoting leukocyte migration to several ECM proteins, including fibrinogen and fibronectin.^21,34  To examine whether α_Dβ₂ can support leukocyte migration, we have examined the ability of vitronectin, as a representative ECM protein, to mediate migration of IC-21 cells. As shown in Figure 5B, cells efficiently migrated toward vitronectin and this process depended on both α_Dβ₂ and α_Mβ₂ because anti-α_D polyclonal antibody and anti-α_M mAb M1/70 blocked the response.

We next sought a molecular basis for ligand recognition by α_Dβ₂. Because the I-domain is responsible for ligand binding in other integrins, and in cell adhesion studies polyclonal antibodies raised against the recombinant α_DI-domain inhibited cell adhesion, we examined the ability of the isolated α_DI-domain to interact with various proteins. Furthermore, because previous studies demonstrated that the length of the C-terminal α7 helix regulates the activation state of the α_MI-domain³⁵  and based on the homology between the α_MI- and α_DI-domains, we have produced 2 recombinant proteins. The first, “active” α_DI-domain, encompasses residues Pro¹²⁸-Lys³¹⁴ and the second, “nonactive,” spans the Pro¹²⁸-Ala³²³ sequence. The α_DI-domains were expressed in E coli and purified from soluble fractions of cell lysates (Figure 6). The capacity of α_DI-domains to bind selected ECM proteins and other ligands was tested using SPR. The protein ligands were coupled to the chip, and the SPR profiles across a range of the α_DI-domain concentrations flowed over protein surfaces were determined. A representative set of SPR sensograms for binding of the active α_DI-domain to vitronectin immobilized on the CM5 chip is shown in Figure 7. The maximal responses achieved at equilibrium for each α_DI-domain concentration (Figure 7 inset) were used to determine the dissociation constant (K_d). The active α_DI-domain bound to all ligands tested, with K_d values in the range between about 0.3 to 8 μM (Table 3). It is noteworthy that the α_DI-domain bound ICAM-3 and VCAM-1, its 2 established ligands.^1,6  Among proteins tested, Cyr61 appears to exhibit the highest affinity for the active α_DI-domain (K_d 0.29 ± 0.07 μM). No binding of the nonactive α_DI-domain was detected.

We previously reported that the α_MI-domain sequence Lys²⁴⁵-Arg²⁶¹ is involved in binding of many unrelated ligands by α_Mβ₂ and, thus, defines its multiligand binding properties.¹⁰  The high extent of homology between α_M(Lys²⁴⁵-Arg²⁶¹) and the α_DI-domain sequence Lys²⁴⁴-Lys²⁶⁰ (Figure 1) suggests that the latter segment may be involved in recognition of multiple ligands by α_Dβ₂. To investigate the role of this segment, we generated a chimeric protein in which the α_D(Lys²⁴⁴-Lys²⁶⁰) was grafted into the corresponding position of the α_LI-domain, the most closely related I-domain but one that does not bind many ligands. To exclude the possibility that this manipulation may cause activation of the chimeric protein enabling it to bind ligands with unusual specificity, the α_LI-domain was expressed in the fixed active conformation. In this protein, originally described by Lu et al,¹⁹  Lys²⁸⁷ and Lys²⁹⁴ in the C-terminal part of the α_LI-domain were substituted to Cys, which resulted in the protein, on the formation of the disulfide bond, being locked in a constitutively active conformation. The α_D(Lys²⁴⁴-Lys²⁶⁰) segment was inserted into the framework of this active α_LI-domain. The control α_L- and chimeric I-domains were purified from E coli lysates and were homogeneous as assessed by SDS-PAGE (Figure 6). The ligand-binding properties of isolated proteins were compared by SPR. No binding of the control α_LI-domain to all proteins tested, except its ligand ICAM-3,³⁶  was detected. In contrast, the chimeric I-domain was capable of binding various ligands immobilized to the surfaces of CM5 chips. The K_d values of interactions between the chimera and different proteins, as determined from the equilibrium portions of the SPR sensograms, were found to be in the range of about 1 to 8 μM (Table 3). Thus, the insertion of the α_DI-domain segment changed the specificity of the α_LI-domain and converted it into the α_DI-domain-binding protein. Although it did not impart the full binding activity, the affinities of ligands for the chimeric protein were comparable with those found with the wild-type α_DI-domain. For example, Cyr61 was the most preferred ligand for the chimera. Thus, these data demonstrate that the Lys²⁴⁴-Lys²⁶⁰ segment within the α_DI-domain is largely responsible for its multiligand-binding properties.

In the present study, we have analyzed the ligand-binding properties of leukocyte integrin α_Dβ₂. The following conclusions are drawn form these analyses: (1) α_Dβ₂ is capable of binding proteins that are either the constituents of the ECM, such as fibronectin, or become ECM-associated during the inflammatory response, including fibrinogen, vitronectin, Cyr61, and plasminogen; (2) within α_Dβ₂, the α_DI-domain is responsible for its ligand binding function; and (3) the α_DI-domain segment Lys²⁴⁴-Lys²⁶⁰ contributes to binding of multiple ligands. Thus, these studies identify the new ligands for α_Dβ₂ and establish this integrin as a multiligand receptor. They also provide insights into the mechanism by which this integrin is capable of recognizing unrelated proteins.

The important finding of this study is that the recognition specificity of α_Dβ₂ closely resembles that exhibited by the major leukocyte integrin α_Mβ₂ (Mac-1). Among integrin family members, α_Mβ₂ has the broadest specificity and has the capacity to bind multiple ligands that belong to different protein families. Protein ligands for α_Mβ₂ include numerous ECM proteins (fibronectin, laminin, collagen, Cyr61), blood proteins (fibrinogen, kininogen, C3bi, factor X), proteases (elastase, plasminogen, MMP-9), and so forth. Based on the overlapping specificities of α_Mβ₂ and α_Dβ₂ in recognition of many ECM proteins, it is reasonable to assume that α_Dβ₂ is capable of interacting with many other α_Mβ₂ ligands. For example, the finding that α_Dβ₂-expressing cells adhere to plastic, which represents a hallmark of α_Mβ₂, lend further support to the idea that both integrins have very similar binding properties.

Ligand binding by the α_DI-domain was found to be regulated by its conformation; whereas the α_DI-domain with its C-terminus truncated (Pro¹²⁸-Lys³¹⁴) was active, the protein with an extended C-terminal end (Pro¹²⁸-Ala³²³) manifested negligible ligand binding. Regulation of ligand binding by the C-terminal part has been described for the I-domains of other β₂ integrins, including α_Lβ₂, α_Mβ₂, and α_Xβ₂.^19,35,37  The high-affinity form of the α_MI-domain can be generated by unlocking the C-terminal Ile³¹⁶ from a hydrophobic socket either by mutation or truncation the α7 C-terminal helix at Lys³¹⁵.³⁵  The fact that the α_DI-domain contains an invariable Ile in the ³¹¹LKEKIFA³¹⁷ sequence, which is highly homologous to the α_M³¹²LREKIFA³¹⁸, and the observation that truncation of the α_DI-domain at Lys³¹⁴ converts it into the active form, suggest that the α_DI-domain undergoes conformational changes similar to those of the α_MI-domain. The I-domains of the α_M, α_L, and α_X subunits have been crystallized in both “open” and “closed” conformations that correspond to the high- and low-affinity states, respectively.^37-39  Although the 3-dimensional structure of the α_DI-domain is not solved, its high homology to α_M and α_X I-domains and similar regulation of ligand binding by conformation of the C-terminus suggests that the α_DI-domain can exist in the “open” and “closed” conformations. Thus, our findings with the I-domain of α_Dβ₂ supports the general mechanism by which the β₂ integrins are activated.

We have previously demonstrated the α_M segment Lys²⁴⁵-Arg²⁶¹ is involved in binding of many unrelated ligands and thus serves as a consensus recognition site.¹⁰  A homologous segment in the α_DI-domain, Lys²⁴⁴-Lys,²⁶⁰ was found to fulfill a parallel function. Grafting this segment into the corresponding position of the α_LI-domain imparted to the chimeric protein the ability to bind numerous ECM proteins and plastic. The binding activity of the chimeric I-domain, based on the estimated K_d, was only 2- to 3-fold lower than that of the wild-type α_DI-domain, indicating that α_D (Lys²⁴⁴-Lys²⁶⁰) is centrally involved in recognition of various ligands. Nevertheless, because grafting of the α_D segment did not restore the binding function completely, other regions of the α_DI-domain could contribute to binding. Taken together, the α_Dβ₂ characteristics, including promiscuity in ligand binding, regulation of ligand binding by conformation of the C-terminal portion of the α_DI-domain, and the role of the highly conserved α_D(Lys²⁴⁴-Lys²⁶⁰) segment as a consensus docking site, closely recapitulate the properties of α_Mβ₂.

Because the α_Dβ₂-expressing cells adhered to the fibrinogen P2-C peptide and soluble P2-C inhibited cell adhesion to the ECM proteins, these observations are consistent with the conclusion that the structural features of ligands permissive for their binding by α_Dβ₂ and α_Mβ₂ are similar. The P2-C peptide duplicates sequence ³⁸³TMKIIPFNRLTIG³⁹⁵, which is the binding site for α_Mβ₂ in the γC-domains of fibrinogen.^18,24  Because P2-C inhibits α_Mβ₂-mediated cell adhesion not only to fibrinogen but also to other ligands,^27,33  it is believed that this peptide contains critical structural information required for α_Mβ₂ binding. Furthermore, the results presented here suggest that recognition of multiple ligands by the α_DI-domain may also depend on sequences typified by P2-C. However, despite the requirements for the “P2-C”-like recognition component and the overall similarity in the ligand repertoire, some proteins appear to be preferred α_Mβ₂ ligands, whereas others are recognized better by α_Dβ₂. For example, the capacity of fibrinogen to support α_Mβ₂-mediated adhesion was higher than that of α_Dβ₂ (Figure 3) and recombinant α_MI-domain bound more strongly to fibrinogen than the α_DI-domain (not shown). On the other hand, Cyr61 was superior to all other ligands in binding by the α_DI-domain (Table 3) and its binding by the α_DI-domain was about 2-fold higher than by the α_MI-domain (not shown). At present, the critical determinants responsible for differential binding by α_D and α_M I-domains remain to be determined.

On α_Dβ₂-expressing HEK293 cells, both α_Dβ₂ and β₁ integrins contribute to adhesion to selected ECM proteins. We found that cell adhesion to fibronectin, vitronectin, and VCAM-1 could be blocked only by the combination of anti-β₁ and anti-α_D (or anti-β₂) antibodies. Indeed, fibronectin and VCAM-1 are well-characterized ligands for β₁ integrins α₅β₁ and α₄β₁, respectively. Moreover, integrin α_vβ₁ on HEK293 cells can bind both vitronectin and fibronectin. Previously, we have demonstrated the same contribution of β₁ integrins to adhesion of the α_Mβ₂-expresing cells.²¹  In contrast, adhesion of the α_Dβ₂-expressing cells to such proteins as fibrinogen, Cyr61, and plastic was entirely α_Dβ₂ dependent with little contribution from β₁ integrins. Although integrins α₅β₁ and α₆β₁ have been shown to bind fibrinogen and Cyr61, respectively,^31,40  both proteins appear to be the preferred ligands for α_Dβ₂ on the α_Dβ₂-expressing cells.

The finding that α_Dβ₂ and α_Mβ₂ have analogous recognition specificity suggests that they may fulfill a common function. Our previous studies with integrin α_Mβ₂ provided insights into how the α_Mβ₂ ability to bind ECM proteins may control cell migration and adhesion. We demonstrated that the progressive increase of α_Mβ₂ on the cell surface led to increased adhesion to fibronectin and, as a consequence, inhibited cell migration mediated by β₁ integrins.²¹  Based on these studies, we proposed that owing to the nonselective nature of α_Mβ₂ binding to ECM proteins and its ability to be progressively up-regulated on the surface of neutrophils, α_Mβ₂ serves as a brake in neutrophil migration at the site of inflammation. Given the similarity in the ligand-binding profiles of α_Mβ₂ and α_Dβ₂, one is tempted to speculate that α_Dβ₂ can perform similar functions. The observations that α_Dβ₂ is strongly up-regulated within atherosclerotic plaques and that its levels are gradually increased on monocyte differentiation to macrophages in the presence of oxidized LDL,²  the major mediator of atherosclerosis, seem to fit this hypothesis. However, a marked distinction between α_Mβ₂ and α_Dβ₂ is that α_Mβ₂ expression in neutrophils involves translocation of the integrin from pre-existing internal pools in response to chemotactic stimuli,⁴¹  whereas α_Dβ₂ up-regulation requires de novo synthesis in the presence of atherogenic stimuli.²  Such a difference in up-regulation of 2 integrins seems to be consistent with a model in which α_Mβ₂ is readily available in the acute inflammatory response, whereas α_Dβ₂ may be required for chronic inflammation. A recent report suggests that not only the recruitment of monocytes, but also their retention within atherosclerotic lesions, contributes to plaque development.⁴²  Whether integrin α_Dβ₂ increases monocyte adhesiveness and thus contributes to their retention in the evolving plaque remains to be established.

In summary, these studies establish leukocyte integrin α_Dβ₂ as a multiligand receptor capable of binding diverse ECM proteins with a specificity overlapping that of α_Mβ₂, the most promiscuous member of the integrin family. Given the capacity of α_Mβ₂ to initiate a multitude of cellular responses in neutrophils, one can expect that α_Dβ₂ plays important roles in monocyte/macrophage biology.

We are grateful to Dr S. Lam for a generous gift of Cyr61. We thank Tim Burke for critical reading of the manuscript and helpful suggestions. We acknowledge the Molecular Biotechnology Core Lab for making the Biacore 3000 available for these studies.